Genomic Feature

um203

ID
ZDB-ALT-160721-30
Name
um203
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Lawson Lab
Current Source
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 14: 15824962 - 15824966 (GRCz11) (1) Details
Nucleotide change
TTGCA/-
Variant Notes
Frameshift at aa 1218; additional 15 aa then stop.
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
5 bp deleted (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
at position 1218 (1)
Sequences
Flanking Sequence
ATAATGATCTATGAATATTTCTTTTAGAAGATCCTATTAAAATGTTAATATAAAATAAAAAACGCCAGACTTTTGAAGAAGATTCATTTAATTAATCTTAACAAGTCTTTGCATTACTGCAGTGTATATTTTTAAAGCTACGTAGCCTTATATAACTAAGCCCTAAAATGTCATCTTACAGCGAAACATGATTGAGGATTATATCTGATATTTATAACTGATGCATTTTAAATTTAGATCTTACCGATTTACTCAACATTAATGAACATAATTTCATTTATTATTTTGGCCATCTGCGGCATATTCTTTTATATAAAACAACATCAGCCATAAAACCCTAATGTATCACATATGACACTCATGACTAAAAAGATATAGTTTGTCTAAAGATTCCATAAACTGTTCCTTTTCCAAATAACACATATCCGGCTTACATAGCTGAGAAGGCTAGAAGTAAATGTAAGGTGATGTAAATGTTGCTGTACCGTGTTGGCAGTGTG
TTGCA/- GGCCAATCTGATCTCCTCTTGTGATGGTGGTCTGGAAGAAGCTTGTGAGAAGCCATCGTCCTCTGAGCTCTGAGACACATTGAACGGGATTTCCTAAAAAAAACACACACACACACACACATGATTACAGTTAATCAAAAACATGTACCATTGGCCATTAGGAATGTAATAGTACAAATATTTGTTCCAAAAAATTCAGGTGAAGGTTTATTAGTTTAGCATGTTTGTGTTTTAAATAATATAATGTCATTTCAAACCACTGCATACTGTATGTACTTTAGGTTTAGAGGTCAGGCTCATTTGAATTATGTGCTTGAGCCTACAGTATTGCAAAACATAAAATACGTTGCTTTAAGAACGTTTGGTTGCACATTTCAGGGGACTAATCAACTAGATGGTTCTGTCTACATTTTGAAAATCTGAGATATGTTACGTAGGGTACGCTTTCTTTTGAAACATTTTAGATATACGACTATGAAAAGACAAAGCTTGCTGTACAG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations