Genomic Feature

um77

ID
ZDB-ALT-160721-3
Name
um77
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one insertion (1)
Protocol
embryos treated with zinc finger nuclease
Lab of Origin
Lawson Lab
Current Source
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Insertion
Variant Location
Chr 21: 37535390 - 37535391 (GRCz11) (1) Details
Nucleotide change
-/CAGA
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
4 bp inserted (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
at position 760 (1)
Sequences
Flanking Sequence
ATATATATAATTTGTACTTTAATCCATTTTATTCTAAGTGCTTGTAAAATGTTTGTCCCAAAAGTATTTGAAGAAAACGGTCAGCTTTTTTTTCTGTGGTGATTTGCATTGTGCGCTCTTGAGCTTGTCCGAAAACATCAACACAACGCGACTCACCCTGACGTAGATTCCCATTCTCTATTGGCCTCTTTACAGCTGTTCAATTCATGTGTTTCTTCTGTTCACATAGCTATCTGATACGTTTGGCCACATAAATACATCTCTAATATACGGATATGATTCTGCTCTTCTGATTTCTCTCTCAATCCCAGAGACAAGGTGGCTCTCAGAGCACGGTTGGCCCGGAGTTCAGCACAGCGGCTCTGATGGAGCACCTAAGAGAAAAAGAGGAGAGGATTTTGGCCCTAGAGGCCGACATGACCAAATGGGAGCAGAAATATCTGGAGGAGAGCGTCATGAGGCAGTTCGCACTGGATGCCGCTGCTTCTGTGGCCACACAGA
-/CAGA GGTGGACACATACACTGCTCTACACTGAACATGCACTGTACAATTAGTTAGTAATTAGTTCTCAAAGTTAAAAATGACCATTGAAAAAAATGTTTGACATAAAACAATGCAAGTTTGCGAAGCATCAGTGTTAAACATCAACTGTAAAGTGCGCTACAGTGCCAATGTGGCAGTTTTTTTATTTAAAGCGACTCTCTATGATATGAAATTAAACTAAAACCCTATTTTTTAAGCCCTTTCACTTCACACTCCAAAGGTAAGGGGTAGGGGTAAAAACATTGAATTGGGCCTAAAAATTGTGATTACTATTGGATAAAAACTAAAACTCTCTGCACCAGTAAATCTAACTTTAAATTAAAGTTTTTTTTTTTTTTTTTAAATCAAGCTATACAGTGCTCAGCATTTATAAGTACACTCATCACAAATCTATCTTTTAAATTCATATTTTTAATAGGAAGCTAAACAATATTATATTTGTGCAAATACATTAGTCAGTACTTG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations