ZFIN ID: ZDB-ALT-160601-3790
Genomic Feature: sa35325
Synonyms:
Affected Genomic Regions: aldh18a1 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 12: 32461551 (Zv9) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
CACCAGGGTCAGACGATGCCAAGCTTTTGGACACATTTTACCCTGGAGAC
C/T
AACAATCAATAACCTATGGCACAAAGTCTAGGGTCGGCATCGGAGGAATG
(1)
OTHER sa35325 PAGES
ZMP:sa35325 (1)
GENOTYPESNo data available

CITATIONS  (1)