Genomic Feature

hu6410

ID
ZDB-ALT-130809-2
Name
hu6410
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
Lab of Origin
Plasterk Lab
Current Source
Other Pages
Note
The vegfchu6410 allele encodes a stop codon at amino acid position 107.
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 1: 38886671 (GRCz11) (1) Details
Nucleotide change
A/T
Variant Notes
The vegfchu6410 allele encodes a stop codon at amino acid position  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
None
Transcript Consequence
None
Protein Consequence
at position 107 (1)
Sequences
Flanking Sequence
ATTTAAATACCAGTATTTAGATCAATATTCCTAATAACACTGCCCTTCAGATTTGTGGATGTGGATACATGAATGACTTTGACTCACCGTCTTGCTGATGTATGAAGTGCTGATGTTCCTGCACTGAAGCTCCTCACTGTTACAGCAGCCCCCACATCTGTAGACAGACACGCAGGGTGGTTTATAGAAGGTGTTTGTAGCCCCAAACTCTTTCCCCACATCTAAACAAACTTGGCGTGGCATGCACAGCGTCTTTCTCCACTCTATCTCAATACCTGGAGGAAGTGCAGCGAGACAGGAAGAAGAGAAACATTAAAAAAAAGGCCACCACTGAAATGCTTTACATGCTGTGTTCATAATCTGACACATTCTTGGCATTCTAAAGATCCTTTTTTGGGTATTGTCAAGCATCAAAATCTCTTGGCTGTCAGACAATAATGACAGAAAAATACTGCCAACACAATCTTTGGCGGTTCTAAATTAATAGTCACTCACTTTTC
A/T AAAGTTCAAGATTGATGAAAGCAGCCGCAAAGGAGGCCTCCTCCGACCTTGTTTCTGTGGAGCTTGGTTCTCTGCGAAGTAAGCGCGACCCCATCTTGGAACGGCACTTCAGCATGATCCGGTAGGTAGGGTAAACTATCCTCATGAGTTCATCCACACTACCCGCTGAACGCAACTGCTCCACCAGGTCTGGCTCTGAATGCTCCTGCTGAGACACAGACAAGCAGGATAGAAACAGCCTCAGAATTCTGCAATCATGTGCCCCATACTAACATTGACACAGCTCTGTCACAATAAAAAATATATACAATTATTAAGTTGACGAACACATACCCACCACTGTGGTCACAAATGAATGACTCCTATTTAAAGGGGTAGTTCATGCAATCATTTACTCACCCTTGCATCGTTCCAAAACAATTTTTTTTTTTAAACTGTCCGGTCACACAATCAGAATGGCATTAAAAGTCACAGGAAACATAAATTACAGCACCACATTA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations