header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-120411-285
Genomic Feature: sa1781
Synonyms:
Affected Genomic Regions: ncor2 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 8: 43400206 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
GAGAGCAGAGAGAGCGAGAAAGAGAAAGAGAGCGAGAGAGGGACAGGGAG
C/T
GAGATCGAGACCGGGAGCGTGAGAAAGATCGAGACAGGGACAGAGAAAGA
(1)
OTHER sa1781 PAGES
ZMP:sa1781 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous ncor2sa1781/sa1781 (TL) ncor2 ♀+/- ♂+/-

CITATIONS  (3)