Genomic Feature

s872

ID
ZDB-ALT-100112-1
Name
s872
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Stainier Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 3: 54591701 - 54591702 (GRCz11) (1) Details
Nucleotide change
AC/GT
Variant Notes
A missense mutation caused a G1459D substitution in the DNA methyltransferase  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
None
Transcript Consequence
Missense (1)
Protein Consequence
Amino Acid Substitution: Gly>Asp at position 1459 (1)
Sequences
Flanking Sequence
GAGGAAAACAAATTAAAAACATTTAATAAGAGCTTTATTTGAAATATTACAACATATAAAAACCTATATAGAATTTATACCACTGTCTTAGAGTGGACAATTGCAAATACATGGTTAAAATCACATTTAGAAATTGATAAAACATCACATGAATGGCACTGCACAGACTGTCCATAGAAAGGCCGCAGAAGTGGCCAAGCTCTACACCAGCTTATGAATAACAAAATGTTTAAAATGGAGTGATGCTTCAGACGGATCCAAACACAATGAAAAATGTGCTTCAATTTTACAGAATGATGGCTTTAGTCAGAGAGCTCCATTTTCTCCTGCTTCACAGGCTCTGAGAAAACACAAGAAATTAAAATGAGATACTCGTTTAGATCAGTGCTTTCAATTTAAAAAAAACTATAAATACCTGTAGCATTCTCCCTCATTTTCTCCAGCACACACTTCTTGACCTCCAGGCCAATGGCTTTGGAGAGGGGTGGAGGAACAGCATT
AC/GT CCAACCTTAGGAAAAAAGAAAAAGTATTACCTAGTGTACGATTTTAAAATGGATGAAAAAAAAAATTGACCAGTGCAGAACACATACTTGTCTGTGTTTGTCTAGCACATTGCCAAAGAAGCGGTAGGTGTCTGGGAAGCCCTGAGAGCGTGCACATTCCCTGACACTCACCACACGGTGCTGCTCAGGGTGAAGGACACGTCCCTGGGGGCAAATAGTTTAAATAAGTACATAAGGCATATGGTGTGCATTGATTCAGTATAAAATGATGCATCAAGACTGGTCAGCATATGGCATGTAGGCAATACCTGCTTTCCCATTGGCTCAGGATTGGTAACTGTAGTGCTGAAGAATCCGTCCCATTCCAGGCGGCCATACAGACCAGCCCAGTGATTATGGCGGTTACCCGTATGAGGCAGACACCAGGGAATCAGGGTGTTGAACTGCCTGTCTGCAGGATCACACGGTTTTCCTAGTGTGATGACGAAGCAGAAAAGTCA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations