Genomic Feature

s644

ID
ZDB-ALT-080710-1
Name
s644
Synonyms
  • slipjig (1)
Affected Genomic Region
Construct
None
Type
Allele with one insertion (1)
Protocol
ENU 
Lab of Origin
Stainier Lab
Current Source
Other Pages
Note
Insertion of single Adenine at nt46. This leads to a frameshift with a premature stop at  AA 41.
Genome Browser
>
Variants
Variant Type
Insertion
Variant Location
Chr 5: 19399718 - 19399719 (GRCz11) (1) Details
Nucleotide change
-/T
Variant Notes
Insertion of single Adenine at nt46. This leads to a frameshift with a  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
1 bp inserted at position 46 (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
None
Sequences
Flanking Sequence
TGTTAAAACAGGCAATTAACTGCAAAAGCAAACGCATAGACACAATATTTACGACAATGAATATAAAAGAAAGGAACATTTTTAAACTGTAGAGTTTATGAACAGGTGCAGAAGAGATATGTGCTTTGTTTACTAAACCGGGATCATCAGACGTCATCAGTCACCGTTAACTTACCTGTCAGTCTGCTCGCATCAATTCTATCGAGTAATTTTAACAGAAAACGTTAAATTTTTTCTTATATTCTGACGATTTTGTCACGTATTCAAACCTTCAGACATTTATGTAGAGACATTATTCTTCAGACTGTATTATATGTCATTATGAAACAGGTGCGCAGCCTCTTGGATTGTTTGAAAAGAACAACAAATAAAAGCACGAAATAAACAGCATCTTACCTGTTTGTTATGATGTTGTTCTGGGTTATAGAAAATCTTTGATAACCAGACGGAGGAAAGCTCTAGTGTTGGTCGGGGCACTTGTTGTCCCGCACGAAAAAACCG
-/T TTTTTTAAATTTCCCTCGTCCCTGCAGTTTGCTCTGGACGGTCATGCGCACTGTGTGCACGCGCAGCGCGAGCCGTGATGAGAGGAGGGGGTCTCGCGCTCTGACTGACAGCTGTTGCCTTGCCTGCACAATCACGAAGATTATCTGTCAGAGCATCTCACCCGACTGGTCTTTACTGTTTTTGTTTAATCAATACCTTTCTTTCTCAAAGACTTGCTCTTTTCTTCCTAGTTTTCTTTGTGCAGTCCACAGGTGCGCCTTTTCGGGTCCGGTCCAACTTAATTATGTCCAAATATACACAGAAATTGGAGTTCAGAAAAAAAATCCTTCTATATAAAAGCCATATTTACATACTATAAATCCCTAAAAAAAACATTATCTCGGGAAAAAATGAATAGAAATCCCTATGAAGCCGGAGAGCTGGAACAGTTTCAGCAGTGATTGCCATGTTCCTTGTAACCTAGGAGACATGAAGTAACACAGACAAAAGTTCCTGATATT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations