Genomic Feature

s403

ID
ZDB-ALT-060824-4
Name
s403
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
ENU 
Lab of Origin
Stainier Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 8: 27756007 (GRCz11) (1) Details
Nucleotide change
T/C
Variant Notes
This allele bears a T -> C base change at position 454, leading to the  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>C at position 454 (1)
Transcript Consequence
Missense (1)
Protein Consequence
Amino Acid Substitution: Ser>Pro (1)
Sequences
Flanking Sequence
TCTTTCACATTAGACAAAAATAATACACATTTTTTTAATCACACACTTTTAGTAGAATCACAAAACTGTAAAAAAAAAAAAAACATACATTCCTTGTAACTCTCATCATTTACACTTGGGTATTTTTCTTACATTCAGCAGCCTAAATAAAGGAATCAGCATGAGTGACATTAGTCCAAACATGCAGAACGCTTAGAAATAGTAGGTTAAGGGTAGAAAATATCTGTGGCAGTTCACTATCAGACGGCTAGCCTTCAAACAATTTATCCAAGCAGAGAATGGGCCACCCTGGAGGGATTAGGCCTGTACTAATATTTAAACCAAACACTCAGGGTCCAGTCTTACCCCTATAGCTGGGAAAAAATGTGAAGTTCTGTTGTGCGATTATATAAGATCCGAGGGTAAATTAAGCTAATTAAGAATCGAAATGTGTTTAATGTGGCTTCATGATTGTTGTTTTTTCAGGTAGTCGTGAGGCAGCGTTCGTATACGCGATCTCC
T/C CGGCTGGTGTGGTTTTCGCTATTACCCGCGCTTGCAGTCAAGGGGAGTTGAAGGCGTGCAACTGTGACCCACAGAAACGTGGACGAGCCAGTGACGAACGAGGAGAGTTTGACTGGGGAGGCTGTAGTGACAACATCAACTATGGGATAAAGTTCGCCAAAGCCTTCATAGATGCCAAAGAGCGAACTGTGAAAGACGCACGAGCGCTCATGAACCTTCATAACAACCGCTGTGGAAGAATGGTGAGAACGAAGGTTATATGACATATTAAAGTTGATTTAGGCCATGTCCACAAATAAATGAGTATTTTTATAAATGGTGTTTTCCTCACTTTTGTTTTTTTAAAAAAATCTCTGTCCACATGAAAATGCCAAAACGCACTGGGATGCGTGTTGAAGGCACACCCGACCAACAGGCGGCCGTAATGACACTTTTATACTGAAATGCGGAAATAAGTATTTGTATGAGTAAATTCTATAAAATCAAAGCAAACATGAGTA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations