ZFIN ID: ZDB-ALT-001221-2
Genomic Feature: a13
Synonyms: nrb (1)
Affected Genomic Regions: dlat
Type: Point Mutation (1)
Protocol: ENU 
Lab Of Origin: Dowling Lab
Location: Chr 21: 23021057 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>T (1)
Transcript Consequence: Premature Stop (1)
Protein Consequence: Polypeptide Truncation: Arg>Stop at position 554 (1)
FLANKING SEQUENCE (GENOMIC)
ACGGTTTCTCTAGGAACTTGCGAAACTCTGCCAGCCATTGAGCGCCAACAGCACCATCAACCACCCGGTGATCGCAGCTCAGAGTCACAGACATCATGTTAGCCACGTCAAACCTATCAGAGACACAGAAAACACATGCAGTAGAAGACTTATTTTTCTGCTTTTCAGACGTTATTAGTGATGGCAGTTGATTGTCAGTTTATTTGGTTTGCTCACCCTTTTTCATTGTCCGCAGGCAGCAGTCTCTTTTCTGAGCCACCCACAGCCAGAATGCAGGCTTGAGGAGGATTAATGATAGCTGAAAAATGCTTGATGCCATACATGCCCAGATTGGAAATAGTGAAGGTTCCACCCTAGAAAACATATATTTCATACATATATATTTAATATAAGTATATATGTTCTATTATTATTCTTTAAATAGCCATTATATTAGAGTTTAGGGTCAGTATGTTTTATGTATTTTACCTGGAATTCATGAGGTTGTAGTTTCCCATCTC
G/A
TGCTTTAGCAGCTAACGCGGAGACGTCTTTGCTGATATTTGCAAGGCCCTTAATATGAGCATTAAATACAATGGGAGTGATGAGACCCACAGGCGTGCTGACCGCCACACTAACATCCACCACGTGATTTCTGTGAGGAGAGGAAAAAAACATTATTTACAGGTCCTAAACCGATAGTTCTTTACGTTTACAAACTTTTATGAGTTTCTTTCTTCTGTCAAACACAAAAGAAGATATTTTGAAGAATGTTGGAAACCTGTAACTTTGACTTTTTTGTTTTCCCTATTATGGAAGTCAACGGTTACAGGTTTTCAGTTATCTTCAAAATATCTTCTTTTTAACTGCTTTTATTAATTAAGCATGACTAATAAATCACAAAAAACTACAGAATGACCTCACAGAAGAAATGATTTCACACACTTGACTGAAGTTATGAAGCGAGTAAAAACATGTTATTAAATGTGGTATTTAAGTGCAGTTCATTGAGCATCTACCCACAC
(1)
OTHER a13 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous dlata13/a13 (AB) dlat Unknown
Heterozygous dlata13/+ (AB) dlat Unknown

CITATIONS  (9)