ZFIN ID: ZDB-ALT-000412-8
Genomic Feature: i26
Synonyms:
Affected Genomic Regions: aldh1a2
Type: Point Mutation (1)
Protocol: ENU 
Lab Of Origin: Ingham Sheffield Lab
Location: Chr 7: 30341642 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: G>A (1)
Transcript Consequence: Missense (1)
Protein Consequence: Amino Acid Substitution: Gly>Arg at position 204 (1)
FLANKING SEQUENCE (GENOMIC)
GCCTGGCAAAATATTGACGACTCCCGGTGGAAACCCAGCCTGTGAAAACAGTATGAGAGGAAAAAGCTTTAGACAAGAGTTGAGCCAAGAACACCACAGGCCGTGGAGGGGGAATCCAGGCCCACCCCGACCTCCCTACAGGCCCTGTGGAAGAGAGGATGGACAGAACATCAAAAGAAGAGAAGAAAGTAGGCCTCTTAATCCCAGAGAAAAGGGAGAGGCAGAACAACAAAAGTCTGGCTGCAGCAGGGAACAAATGATGAAATATCACGCATTTGCATCTGTAAGTGTGTTGATGTTGCTTTTGGATGACTTTGATCACTGTACGGCTGCATTATGGATGTGTTGTGGTCAGAATGGACAGACAGATATCAGAATGTTCAATCTGTCCATTCACAACAGTGTTGTAAAATCATAGTGCTGTACCTCTTTGATCAGAGCGCCGAGGTAGAGGCAGGTGAGAGGGGTTTGCTCAGCAGGTTTCAGGACAACCGTGTTCC
C/T
GCAGCTCAGCGCCGGCCCCAATTTCCATGCTGTCATCACCAGGGGGAAGTTCCACTGTACAGACATAGGTCAGGAACTTACTGTGGGAGCTCGTTCAAACAAACTCATATCTTTGTTTCTGAAGAGCATAACTCCTTCACTAATGATATCAGGCTCTGCACGCTCATTTAGAAACTGAAAATTTCTGTATCAATCCAGTCTGGTTACTTTGTGACCTAAGCATATTTTTGTTCATGAGGTGATTAATAAGAACAAATAGAGTGCTTACAGTTATCTTTTTTGTGTGTGTCACCCTTTCTATTTCTGTCTTTCAAGTGTACCTCCCACTCATTCCTTCCTTTCTCTTTCATTATTTTCTTTGTTCCGTTTTCTGTCTTCTCTGTCTCACTGGCACTGGCCATCATTTCCCTCTGCTGACCTGTTTTTAGCCAATCATACACTGACAGATAAGACACTTAAATACTTCCAGTAATCTGCAAAATTTACTTTAAACCCATTGA
(1)
OTHER i26 PAGES No links to external sites

CITATIONS  (36)