Transcript

abca1b-202

ID
ZDB-TSCRIPT-240508-3160
Name
abca1b-202
Previous Names
None
Transcript Type
mRNA
Annotation Status
Annotation Method
Ensembl
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
ENSDART00000148461 [ Show ] (double-click sequence to select) [Download]
>tpe|ENSDART00000148461|gene_biotype:protein_coding|ENSDARG00000079009 transcript_biotype:protein_coding  ensembl:known chromosome:GRCz10:14:6122672:6212349:1
GAATAGCACCATTAGCATAGAGCAAGATCTCGACTTCCAG
CAAACCTGTTCATTCGAAATGATCAAACCATTAAGAGACT
CTAACGGCCTGCGAAATTCCTTTCTTGATGAATCTCTGAC
ACTACAAGGTCCACCACTTCCAGGAATTCTGGAAAAAAAA
AAGACAGGAGATGAAAAGGGAAGACGTGTGAGAGAGCAAG
CGAACGCTGGAGAGTAAGATAGGAGCTGCTGCACTTTGTC
CTGGACTTTTGAGCTGCTCTGTTGGTCGCTGCTGGATGCT
TTTTTGTCAGTCAGCCCCGTCTCCGTTGTGTCATTGCAGT
TGAGAGCTGAGCGCGAAGAGGGACCCGAGTGAAGATGTCC
ATCTCCACTCAACTGGGTCTGCTGCTGTGGAAGAACTTCA
CCTACAGACGGAGACAAACGCTCCAACTGCTGACTGAGAT
TGTGTGGCCTCTCTTTATTTTCTTCATCCTGATCGCCGTG
AGGTTGTACTACCCGCCTTATGAACAACATGAATGTCACT
TTCCCAACAAAGCCATGCCCTCAGCAGGCACCCTGCCCTG
GATCCAGGGCATCGTCTGCAATGCCAACAATCCGTGCTTC
CGCCACCCAACCCCAGGGGAATCTCCCGGAGTCGTTGGGA
ACTTCAACGATTCCATAATCTCACGCCTTTTTTCTGATGC
CAAGAAGATCTTGTTGTATAGTCAAAATGACAAGAGCTTG
GATGGGTTCAAGGAGCTCATCGACGCTGTAAAAGTCATGC
AAAATAACACGGCCGGATTCAAGCTGAAGGACTTCCTGCA
TGAAGACGAGACCCTCTCTACCTTCCTCCTACAAAACGCC
TCATTTACAGAGAATTATGTTACGAATATTCTGGACGCTG
ATGTGAATCTTGAAAAGGTGCTGATCAAAGGTTTTGGCGT
CCATCTCAGAGACATGTGCAGCTCAATCAAACTTGAGGAT
TTTGTGACCATCCCGGACACAAGTGTGGCCAGATTCACTC
AGGACATGATCTGCAGGTCTCCCAAAAACTGGCTGGACCA
GGCCGAGAGTCACTTCAAGTCCAATCTGGATTTCCTCAAA
CCTGTCAGGTCAGAAATAAGGACTAATGCCACTGATGTCC
GTAAAGTTACCAAAGCCACAGACAACCTTCTGGAGAGCCT
GGGATCACTTGCTGTGGAGCTGGCCAGTATGAGGAGTTGG
AGTGACCTGCGAAACGAGATCCTGTTTCTGACCGAAAATG
CCACTGGCTCCCCAAGTCTGATGTACCAGGCTGTGTCCCG
TATCGTGTGTGGACACCCTGAAGGCGGTGGCCTCAAGATC
AAATCCCTCAACTGGTACGAAGACAGCAACTTCCAGGCGC
TGTTTGGCAACCACAACGACAGCGATGACCAACCGGTTCC
AGTCTACGACAACACAACCACTCCATACTGTAACAGCATG
ATGAGGAACATGGAAGCCAGTCCCATCTCTCGAATGATCT
GGAGAGCACTGAAACCTCTTCTTATGGGGAAGATTCTCTA
CACTCCACATAGCCCTGCAACACAGAAGATCATTCATGAG
GTCAACAAGACATTTCAAGAGCTCGGAATTCTGCGAGATT
TAGGAGGAATGTGGGAAGAAGCCAGACCGAAGGTTTGGAA
CTTCATGGAGAACAGCAATGAAATGGATCTAATGCGGACA
CTTCTACTCAACAACCTCACGGCTAATTTTTTTAGTGCCC
AGTTGGCTGGGACTCAGTGGAGCGTAGAGGATGTGATAAG
CTTCTTGTCCAAGCACTCTGAAGACACGCGTCCCCAAGGA
ACAGCGTTCACATGGCGGGATGTCTTCAATGAGACCGACC
AGGCCATTATGAGCATATCCCGTTTCATGGAGTGTGTAAA
CCTGGATAAGCTTGAACCCGTGAGCACAGAGGAGAAACTG
GTGAACGAGTCCATGAGCCTCCTGGATAACAGAAAGTTCT
GGGCTGGGATTGTATTCTTAGATATACCATCTAACAGCTC
TGAACTTCCACCCAACGTCAACTACAAGATCCGCATGGAC
ATTGATAATGTGGAACGCACAAACAAGATTAAAGATGGGT
ATTGGGATCCAGGTCCCAGGGCTGATCCTTTTGAGGATTT
GCGGTATATTTGGGGAGGATTTTCCTATCTTCAGGATGTG
GTGGAGCACAGCATCATCAGAGCAGTTACTGGATCCAAAG
AAAAAACTGGTGTTTACATCCAACAGATGCCTTATCCATG
TTATGTAGATGATATTTTTCTGCGCATTATGAGCCGCTCA
ATGCCACTGTTCATGACTCTGGCCTGGATGTACTCGGTGG
CCATCATCATCAAAGGCGTCGTCTATGAGAAAGAGGCCCG
GCTTAAGGAGACCATGAGGATTATGGGATTGGACAACGGG
ATCCTGTGGTTCAGCTGGTTTATTAGTAGCCTCATCCCTC
TTCTCATTAGCGCAGGCTTGCTGGTTCTTCTGCTCAAGAT
GGGAAATCTCCTGCCCTATAGTGACCCTGGGGTCGTCTTC
CTCTTCCTCGGGTCATTTGCTGTAGTGACCATCATGCAGT
GTTTCCTGATCAGCACGGCGTTTGCACGTGCCAACCTGGC
AGCGGCCTGCGGGGGCATCATCTACTTCACTCTCTACCTG
CCTTATGTGCTGTGCGTGGCCTGGCAGGACTATGTGGGCT
TCGCCGCCAAAGTCATCGCTAGCTTACTGTCTCCGGTGGC
GTTTGGCTTTGGCTGTGAGTATTTTGCCTTGTTTGAGGAG
CAGGGTGTGGGTATTCAGTGGAATAACCTCTTCTCCAGTC
CCGTGGAAGAGGACGATTACAACCTCACCACCTGCCTCAT
CCTCATGTACTTTGATGCCTTCCTGTATGGGGTCATGACC
TGGTACATAGAAACGGTGTTCCCAGGACAGTATGGCATTC
CCAGGCCATGGTACTTCCCTTTCACTAAATCCTACTGGTT
TGGAGAGAACAGCACAAACAATACTGCAATACACGGAAAG
AAGAGCAATGCAGGGGCTGTTTGCATTGAAGAGGAACCTA
CTCACCTTAAACTGGGAGTTTACATTGAGAATCTGGTGAA
GGTCTATCGCCATGGTAAAAAGCTAGCCGTGGATGGGTTG
ACACTTGGTTTTCATGAAGGTCAGATAACATCCTTCCTGG
GTCACAACGGAGCTGGCAAAACCACCACCATGTCTATCCT
CACAGGCCTTTTCCCTCCCACCTCTGGCACTGCATACATC
ATGGGCAAAGACATTCGTTCAGAGCTGAGTTCAATCAGGC
AGAGCCTCGGAGTGTGTCCACAACACAATGTCCTCTTCAG
CATGTTGACAGTAGAAGAGCACATCTGGTTCTATGCTCGC
CTGAAGGGTCTGTCTGAGGAAGAAGTGAAAGCTGAGATGG
AGCAGATCCTGAGTGACACTGGCCTTCCGCACAAACGCAA
ATCCAGAACCAGCCAGTTGTCAGGTGGTATGCAGAGGAAG
CTCTCAGTAGCTCTTGCTTTCGTTGGAGGGTCAAAGGTTG
TCATTCTGGACGAGCCTACTGCTGGTGTGGATCCATATGC
TCGTAGAGGCATTTGGGACCTTTTATTGAAGTACCGTGCA
GGTCGTACAATACTTCTTTCTACCCATCATATGGATGAAG
CAGACATTCTGGGTGATCGAATTGCTATCATCTCCCATGG
AAAGCTTTGCTGTGTGGGCTCCTCGCTGTTTCTTAAGACT
CAACTGGGCACCGGATACTATCTTACATTAGTGAAGAAGA
ACACTGAGCCTTCTCTCAGTTCTTGCAGGAACTCAAGTAG
CACTGTGTCATTTGTTAAGAAAGATGATAATGCATCTGAG
AGCAGTTCGGATGCTGGTCTAGGTAGCGACCAAGAGAGCG
AAGCAGCCACAGCAATCGTTGATGTAACCATCATTTCCAG
GCTAATCCTAAAGCATGTTCCTGCTGCCCGCATGGTGGAA
GACCAAGGCCACGAGATCACATATGTGTTGCCATATGAGT
CTGCTAAAAACGGTGCTTTTGTTGAGCTCTTCCATGACCT
AGATGATCGGCTTGCAGACCTTGGCATTTCCAGCTATGGT
GTCTCAGATACTACACTTGAGGAGATTTTCCTAAAAGTGG
CGGAGGACAGCGGAGTCGACACTGAAATGCTCTCAGACGG
AACTCTGCCGGTGCGCAGACAGAGACGACATGCATTTGGT
GCTGATCACCAGAGCTGCCTGAAACCCCTGACCGAAGACG
ATAGCTTTGACTGCAATGAATCTGAGGGTGATCCAGAATC
CAAAGAAACTGACTATTTGAGTGGGTCAGATGGCAAAGGA
TCATATCAGGTGAAAGGCTGGAGTCTGAAGAGGCAGCAGT
TTGTGGCTTTATTATGGAAGAGACTGCTTTACGCTCGCCG
CTCTAGGAAAGGATTCTTTGCACAGATCGTTCTTCCTGCT
GTGTTTGTGTGCATCGCTCTGGTATTCAGTCTCATTGTGC
CGCCATTTGGGAAATATCCCAGCCTGGCTCTTAATCCCTG
GATGTATGAAGAGCAGTTCATGTTCTTCAGTGAAGATGCT
CCTTATGACGTAAGCACACATAAGTTGCTCAGAGCTCTGT
TTGATGATCCTGGCTTTGGAACACGATGCATGAAAGGAGA
ATCAATTCCGGATGCTCCCTGTACAATGGGCGATGAGGAA
TGGTCTACACCAGAAGTGCCAGAAAGCATAATAGAGATTT
TAACAACAAGGAACTGGACTATGAATGACCCATCGCCTGC
TTGTGAGTGCAGCTGTAATGGCAAAAAGAAGATGCTCCCA
GAATGCCCTGCGGGTGCAGGCGGTCTCCCACCTCCTCAGA
TTAAGATCAGTGAAACTGAGACTCTCCAGAACCTGACAGG
ACGAAACATCTCAGACTATCTAGTGAAGACCTACGCACAG
ATCATTGGAAAAAGCTTAAAAAACAAGATCTGGGTGAACG
AATTTAGATATGGAGGATTTTCATTGGGAGCCAGAAGCAC
TCAGGTACTTCCTCCAGCTGAGGAGATTGACGACGCCATC
TCTAGAGTCAGGGAGATCTTCCAACTGGGGAAGGACTCAG
GATCAGCAGCCGACCGTTTCTTAAAAAGCCTGTCTGCATT
TATCAATGGGTTGGACACTAAGAATAATGTCAAGATTTGG
TTTAATAACAAGGGCTGGCACAGTATTGGGGCCTTCCTCA
ATGTAATGAACAACGGTATCTTGCGTGCAAACTTACCACC
CGGTAAAGACCCCAGTGAGTTTGGCATCACTGCGTACAAC
CATCCACTCAATCTGACCAAGGAACAGCTTTCTCAAGTGG
CGCTGATGACTACCTCGGTAGACGTGCTGGTTTCCATCTG
CGTGATCTTCGCCATGTCTTTCGTCCCTGCTAGCTTTGTT
GTCTTCCTCATCCAAGAGCGAGTGAACAAAGCCAAGCACA
TGCAGTTTATCAGTGGAGTTCAGCCATATCTCTACTGGCT
GGCAAACTTTCTCTGGGATATGTGCAATTATGTTGTTCCT
GCCACTCTGGTGATCCTGATCTTTGTGTGCTTTCAACAAA
AAGCCTACGTTTCCGCCACCAACCTGCCTGTTCTTGCCCT
GCTTCTGCTTCTATATGGATGGTCCATCACTCCTCTTATG
TACCCAGCATCCTTCCTCTTTAAAATCCCCAGCACTGCTT
ATGTGGTTCTCACAAGCGTCAACATCCTCATTGGGATCAA
TGGCAGCATTTCAACATTTGTCATGGAGTTATTCGGAAAT
CATGAAATTGGAGGAATTAATGACATCCTGAAGAACGTTT
TGCTCATCTTCCCACATTTCTGCCTGGGTCGAGGTCTCAT
CGACATGGTGAAGAATCAGGCCATGGCTGACGCTCTGGAG
AGATTTGGTGAGAACCGTTTCCGTTCTCCACTGGAGTGGG
ACATGGTGGGTAAGAATCTTTTCGCTATGGCTGTGGAGGG
TGTGGTTTTCTTCATTATCACCGTCCTCATCCAGTACAGA
TTCTTCTTTGAACCCAAGTCTTTATGTCCTAAATTGAGTC
CGATTGGAGAGGAAGATGAAGATGTAGCCAGAGAGAGGCA
GAGGATCATGAGTGGGGCCGGACAGGGAGACATTCTCGAA
CTCCGACAGCTCACTAAGGTGTACAAGCGGAAACAAAAGC
CTGCAGTGGATCGTCTGTGTGTTGGCATTCCTCCAGGAGA
GTGTTTCGGTCTGCTTGGTGTCAATGGAGCAGGAAAAACC
AGCACTTTTAAAATGCTGACCGGAGATTCTGTGGTCACCA
AAGGAGAAGCGTTCATAGCTGGGAAAAGTATACTTAGGGA
AATCGATGAAGTACATCAGAATATGGGCTACTGTCCTCAG
TTTGATGCCATCAATGATCTGCTAACTGGACGGGAACACC
TGGAATTTTATGCTATCCTGCGTGGTGTACCTGAGAACGA
AGTTTGTGCGGTGGCGGAGTGGGGAATCCGTAAACTGGGC
CTGGTGAAGTATGTGGACAAAAACGCTGGAAGCTACAGTG
GAGGAAACATGCGCAAACTGTCCACCGCCATATCACTGAT
TGGAGCTCCACCAGTGGTCTTCCTGGACGAGCCCACCACT
GGGATGGACCCCAAAGCACGCAGAGCCCTGTGGAACTGCA
TACACAGCGTCATCAAAGAGGGCCGATCTGTTGTTCTCAC
CTCACACAGCATGGAGGAGTGTGAAGCTCTGTGCACCAGA
ATGGCCATCATGGTGAACGGCAGGTTTCGCTGTCTGGGCA
GCGTCCAGCACCTCAAGAACAGATTTGGCGACGGGTACAC
CATCATTCTAAGGGTGGCAGGCCCTGATCCCGACCTGCAG
CCGGTGATGAAGTTCATCGAAAGCGAACTTCCAGGGAGCA
CGCTGAAAGAGAAGCACAGAAACATGCTGCAATATCAGCT
GCCTTCATCACTCACATCCCTCGCTCACATCTTCAGCATC
CTCGCCAAAAACAAAGAGTTCCTGCGGATAGAGGATTACT
CCGTCTCCCAGACCACACTAGACCAGGTGTTTGTAAACTT
TGCGAAGGACCAAAGTGACGACCACTCGGACAGCTCAATC
AGCCGTAAAGGGACGGCGGTGAACATGGCCCTGCTGACTC
CGCTGTCCACTAAAGACAGCCTGGAGAAGCCCATGGAGAG
CTTCGTATGAGCCGGACTCTCTCTTTACACTACATGCCAA
CGGGAGCCAGTGGAGTCCACACATTTCACATCTTTTTTAT
TTTTTGTGGCCTTCGAGCTGCAGTCTGCCCTCCTGATCCT
CAGGCTGGAGATAAACCCGTGAGAGGCAGACGCCAAATGC
AAGTCAATGCAAAAAAAAAAAAAAAAGAAATCAGAAAGAC
TTCTTGCGTTTCTAGCATGGCGGAATTCAAAGCATGCTAG
TCGCGACGTTAAAACTTGAAGCCATCAATTCTGGTGTGTT
TAGCGACAGTCGTCGATTATTTGAGATAATCGGCCTGATG
GGGGGAAAATGCCAATGATCAATCATTCAGGGGTCCGTGT
GTTTGCATTTTATTTTTTCGTAAGAAAACTGGAAATCACG
TGCTGAAGAATCAATTTTTTTGCACGGAAAACCTCCAAAT
CGTACCTATTTTGGAAATGATTATGTTCGTGATGTGTCTT
TATTTATAAACAAGCCATTGTTTTAGATGTTTTACAAAAG
GGCATTGTTTTATTTTACTCCTAAAGTGCCTTGCGATAAC
TTTATAGTAAACACAAAATATTTGTGTGCGGGCGAAAACA
AAAACGATTGATTTATTATTATTATTATTATTTTTAAATA
AAGTAAGCTTTAAAGTTACACCGTGTAACAAATACCTCGA
ATGACAGCAAATCACTCAAACAACTGAGAAGAAAATCAGT
TCAAACAAACCAATCGTGTGCCTTCTTTGGGAAAAAAAAG
AGGCGTGTCCTGTGAGTCTATTATTGATGGACCAATAAGA
ATACAGAGCTTCCAGCTGTATTAAATTGAGTACAGTAAGG
GTGATCGGTCCGTTTTCATCATTGAATCAGTATTTTGGAT
CTCTTTGGGAGAGGCGACAGCAATGTCAACCTTTCATCCG
AGCACTTTACTTGCTGCGTTAATTGAAAATTTTGATTTAA
TGTCAAAACGTGTTAATCTCTTTGCACTGGATTTTCCACA
GACAATGTTTTTGCCGCTTTTTTTTTTTTTTTTCCTCAGT
GACCGTTTAGTTTCGGTTTGGGTTCGAACAAAGTGATTGC
AAACCTAAAAGGACAAACGTTTTAGCACCACCGTTATGTT
GCTCATTAATATCTGTTTACATTTCAAACTTATGGCTGTG
GAATGTCTGTTACTCGTCTTGTACACTTACTGTATTTACA
CAATAAAACACAACAGTTCTACAACCCTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations