Transcript

epoa-202

ID
ZDB-TSCRIPT-160623-510
Name
epoa-202
Previous Names
  • epoa-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000063413 (1) [ Show ] (double-click sequence to select) [Download]
>OTTDART00000063413 ZDB-TSCRIPT-160623-510 cdna:novel chromosome:VEGA67:7:21624914:21652094:-1 gene:OTTDARG00000027347.2 gene_biotype:protein_coding transcript_biotype:protein_coding gene_symbol:epoa description:erythropoietin a
TGAAGATCCTCTACGGCCTGATCGAGCTCTCCGCCATACC
GCACGTGCACTATGCGACAGGGAACATCATAGAGCTGGTC
AAGAACAAGACTAGCCTCAAACGTCCCGATCCACTCCCTG
GAGCCCAGGAATGAATCAGACACCCATCTGTGTTTGTAAC
GCTACCGCCAGTCCATCAACAGAGGGAGCCAGTGCTTTTG
GAAGTGTGTATAGACCCATTCAGATCCGCTGTGGAGTGCA
CTAGTGTTGGCCAGGCTTTCAATAAGGACTCTTTGCCTTA
CTGCTGATGGTGCTGGAGTGGACCCGTCCAGGCCTGTCCT
CCCCATTACGCCCCATCTGTGACCTGCGCGTCCTCGACCA
TTTCATTAAGGAGGCATGGGATGCAGAGGCTGCTATGAGA
ACTTGTAAGGACGATTGCAGCATTGCAACGAACGTCACTG
TTCCTCTGACCAGAGTCGATTTTGAAGTCTGGGAAGCGAT
GAATATAGAGGAGCAAGCTCAGGAGGTCCAGTCAGGCTTA
CACATGCTGAACGAGGCCATTGGCTCATTACAGATATCTA
ATCAGACTGAAGTGCTTCAGTCTCACATAGATGCCAGTAT
TAGAAACATCGCCAGCATCAGACAAGTGCTGCGAAGTCTC
AGCATACCGGAATATGTACCTCCAACCAGTAGTGGAGAAG
ACAAGGAGACACAGAAAATATCCTCGATCTCAGAGCTGTT
TCAGGTCCATGTCAACTTTCTTCGGGGAAAAGCGCGTCTG
CTGCTCGCCAATGCACCTGTCTGTCGACAGGGTGTCAGCT
GATAAACAATTCAGGGCAAAGGCCAAACTAATCAAAGCTC
CTCATATCAGGAGGCAGGATATGGACTATTACAAAGGAAA
TATATGACTGGGAGTTGTAGCACTTTGAAAGATTTACTCA
CAAAGGGAAGAGAAGACATCCCCCTGAATGCCAAGCGGCA
AACCCACCTGCCAAAATCTACAAGAAATCACTCCTTTTTC
CCCATATGACTGATGAAGCTTGTCCAGCACAACTGGGAAG
GTTTATCTGGGACTCTTTTTCTACTGTTTATGAAATTGTC
ATTATTTATATATATATATTTCCTAGAGCTGGAATCACTG
CAGGTTTTTCTCGGAAGCTGTTCAAGTAAAGACCTCCCTT
TCTCCATCTACCATGGCCTCAAGCACCTCCAACTGTTGAT
AGAGACAACTATTTATCGTTATTAATTATGCACTGTAGGT
TTCTATTAATTTTCGTGGATGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations