Transcript

epoa-201

ID
ZDB-TSCRIPT-090929-17175
Name
epoa-201
Previous Names
  • epoa-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036729 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036729|OTTDARG00000027347|ZDB-GENE-061218-3 epo|OTTDARP00000029458 epo-002 LG_ BX005336.10 Danio rerio protein_coding KNOWN, 1825 bp
CAAAAGGGAGAGGATCCTGTAAGCGCTGGATTCTGAGATG
CAGATAATCAGACTCTTTGCCTTACTGCTGATGGTGCTGG
AGTGGACCCGTCCAGGCCTGTCCTCCCCATTACGCCCCAT
CTGTGACCTGCGCGTCCTCGACCATTTCATTAAGGAGGCA
TGGGATGCAGAGGCTGCTATGAGAACTTGTAAGGACGATT
GCAGCATTGCAACGAACGTCACTGTTCCTCTGACCAGAGT
CGATTTTGAAGTCTGGGAAGCGATGAATATAGAGGAGCAA
GCTCAGGAGGTCCAGTCAGGCTTACACATGCTGAACGAGG
CCATTGGCTCATTACAGATATCTAATCAGACTGAAGTGCT
TCAGTCTCACATAGATGCCAGTATTAGAAACATCGCCAGC
ATCAGACAAGTGCTGCGAAGTCTCAGCATACCGGAATATG
TACCTCCAACCAGTAGTGGAGAAGACAAGGAGACACAGAA
AATATCCTCGATCTCAGAGCTGTTTCAGGTCCATGTCAAC
TTTCTTCGGGGAAAAGCGCGTCTGCTGCTCGCCAATGCAC
CTGTCTGTCGACAGGGTGTCAGCTGATAAACAATTCAGGG
CAAAGGCCAAACTAATCAAAGCTCCTCATATCAGGAGGCA
GGATATGGACTATTACAAAGGAAATATATGACTGGGAGTT
GTAGCACTTTGAAAGATTTACTCACAAAGGGAAGAGAAGA
CATCCCCCTGAATGCCAAGCGGCAAACCCACCTGCCAAAA
TCTACAAGAAATCACTCCTTTTTCCCCATATGACTGATGA
AGCTTGTCCAGCACAACTGGGAAGGTTTATCTGGGACTCT
TTTTCTACTGTTTATGAAATTGTCATTATTTATATATATA
TATTTCCTAGAGCTGGAATCACTGCAGGTTTTTCTCGGAA
GCTGTTCAAGTAAAGACCTCCCTTTCTCCATCTACCATGG
CCTCAAGCACCTCCAACTGTTGATAGAGACAACTATTTAT
CGTTATTAATTATGCACTGTAGGTTTCTATTAATTTTCGT
GGATGTATGTGTGGGTGTGTGTGTGTGATTTTTGAGAATG
CTGAGAATGGATGTGTCGGACGTCAGGAGAGGATGGTTGT
AATTCTGAATTCTTACGGGTCATTTGGGGTGAACAGGATG
AAGGGCTAGATTGCTGCTAGTGTCGAGCGAATTGGAAACT
TTCGTGCGAGCTGATGAGGCTCATGTCCGAAACACGCCGA
TGAGTGTGGCCTTGTACAGATAACACCGCTGCCAGGAAAA
ATATTGATTAGCGTATGACGAACATCCTGGCTTACTTCCA
CTTCACGCACGACGCTGCATACTTGCCTTTGGGAAACGGT
CGTAAGGTTGACATTTTGTTGCTGTTTTTCTGGACTTGTT
TGTAGTCTTTCGTAAATAGCCAGTTTTTTTTACATCTGTC
AATCAGTCAGTCTGAATGCAACAAAGTATGTTTGTAGATG
TTTTTTCCTGTTATTTTGCTGTTTTTGTGGTTCTTTCATC
ACAACGCTGTTTGGTTTTCAAATACACAGTATTATTCTTA
GCTACAAACATAGTGAAAACAAGAAGAGTGGAAGTTTTTG
TCTTATGAAGCATCTCTAGTGAGAATGAACCAAAACACTG
TAAATACATGTGATTCCAAAGTGTATTTGATATGAAAGCA
AGTACTTTTTTTTAGCTATTATGGAGAGGAATATAGGCAT
ACATTATGCCTAAGCCATAACTGGATTATAAAATAAGTAA
TGGATTTTTGTCATGTTGTTTCTTCTGATGGAGTTTAGTC
ACACCACTAAATATTTTTGAACACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations