Transcript

si:dkey-83f18.9-202

ID
ZDB-TSCRIPT-160112-873
Name
si:dkey-83f18.9-202
Previous Names
  • ottdart00000063002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000063002 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000063002|OTTDARG00000023499| DKEY-83F18.9|OTTDARP00000049261 DKEY-83F18.9-002 LG_ CR318646.27 Danio rerio protein_coding NOVEL, 1022 bp
AAATGGCTCAGTCTCTATATTTCCCTCTTCTCCTCATTGC
TCTCTGCTCCATATCTGAATGTGTTCAGCGTCAGTATCAC
TTTATAAATGAGACAAAGAACTGGACTGAAGCTCAGAGAT
ACTGCAGAGAGAATTACACAGATCTGGCCACTGTTGACAA
CATGAACGACATGATCGAGCTGATGAAGAGTGTGAAAGTG
AATGATAGACGTGTCTGGATTGGTCTTCAGAGGACAAGTG
ATTATAATTGGCATTGGTCTTCAGGTGATCCTACACTGTT
TAAGAACTGGGCATCTGGACAACCAGTCGGCGGTGATAAA
TGTGCTTATATAATAGGTGGACAGTGGTATGTTTTGCCAT
GTAGTGCCACCTACACATCATTCATCTGCTACAACATGAG
CAGAGGACTGGTGTATGTCAAACAGTCAATGAACTGGGTA
GACGCTCAGAGTTACTGCAGACAGAATCACATTGATCTGG
TCAGTGTGAGGAACCAGAATGAGAATGAACAGATGAAAAC
GTTCATTAATGACAGAAACTTATCTGGATCTGGAATCTGG
ATCGGTCTGTTCAGAGACACATGGCAGTGGACAGATCAGA
GCAGCTCCTCATTCAGATACTGGAATACAGATAAACTGAT
TGTGGTCCAGCAGAATCTGTCGTGGTCTGAAGCTCTGAGA
TACTGCAGACAGCATCATGTGGATCTGGTCTCGGTTCAGT
CAGTGGAGATGCAGTATGAGGTGATGAACGTGGTTAAACT
GGCGTCTACTGAGGCGGTGTGGTTGGGTTTACGATTCTCC
CACATTTTGGACATCTGGTACTGGGTGAGTGGAGAGACCG
TGTGCTATCAGAACTGGGCTCCAGGGAACGGCACATCAGA
GAAGATTTGTGAGCCCACAGTGAGTTCTGGAGCAGTTCAG
TCTGGACAAGGTCAGTCCTGGATCAGCCGTCCTGAAACTG
ACCGGCTCAACTTCATCTGCACTAAGTACTAGGATTGAAA
GACCTGAGGATGTTTGTTTAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations