Transcript

si:dkey-83f18.9-201

ID
ZDB-TSCRIPT-090929-12790
Name
si:dkey-83f18.9-201
Previous Names
  • si:dkey-83f18.9-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000030629 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000030629|OTTDARG00000023499|ZDB-GENE-070705-508 si:dkey-83f18.9|OTTDARP00000024945 DKEY-83F18.9-001 LG_ CR318646.27 Danio rerio protein_coding NOVEL, 1204 bp
TAGAATCAGGCAGTCTGAATTTGCAGACAGACACATCAGA
CTGAAGACAGAAACACACCAGCTCTGAGAAATGGCTCAGT
CTCTATATTTCCCTCTTCTCCTCATTGCTCTCTGCTCCAT
ATCTGAATGTGTTCAGCGTCAGTATCACTTTATAAATGAG
ACAAAGAACTGGACTGAAGCTCAGAGATACTGCAGAGAGA
ATTACACAGATCTGGCCACTGTTGACAACATGAACGACAT
GATCGAGCTGATGAAGAGTGTGAAAGTGAATGATAGACGT
GTCTGGATTGGTCTTCAGAGGACAAGTGATTATAATTGGC
ATTGGTCTTCAGGTGATCCTACACTGTTTAAGAACTGGGC
ATCTGGACAACCAGTCGGCGGTGATAAATGTGCTTATATA
ATAGGTGGACAGTGGTATGTTTTGCCATGTAGTGCCACCT
ACACATCATTCATCTGCTACAACATGAGCAGAGGACTGGT
GTATGTCAAACAGTCAATGAACTGGGTAGACGCTCAGAGT
TACTGCAGACAGAATCACATTGATCTGGTCAGTGTGAGGA
ACCAGAATGAGAATGAACAGATGAAAACGTTCATTAATGA
CAGAAACTTATCTGGATCTGGAATCTGGATCGGTCTGTTC
AGAGACACATGGCAGTGGACAGATCAGAGCAGCTCCTCAT
TCAGATACTGGAATACAGGTGAACCAAATAATAGTGGAGG
TCATGAAAACTGTACAGTGCTAATGGAGAACACTCAAGGA
TATTGGGCAGATGTTCCTTGTGACTGGCAGTATCCTTTTG
TGTGTCATGAAGATAAACTGATTGTGGTCCAGCAGAATCT
GTCGTGGTCTGAAGCTCTGAGATACTGCAGACAGCATCAT
GTGGATCTGGTCTCGGTTCAGTCAGTGGAGATGCAGTATG
AGGTGATGAACGTGGTTAAACTGGCGTCTACTGAGGCGGT
GTGGTTGGGTTTACGATTCTCCCACATTTTGGACATCTGG
TACTGGGTGAGTGGAGAGACCGTGTGCTATCAGAACTGGG
CTCCAGGGAACGGCACATCAGAGAAGATTTGTGAGCCCAC
AGTGAGTTCTGGAGCAGTTCAGTCTGGACAAGGTCAGTCC
TGGATCAGCCGTCCTGAAACTGACCGGCTCAACTTCATCT
GCACTAAGTACTAGGATTGAAAGACCTGAGGATGTTTGTT
TAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations