ZFIN ID: ZDB-TSCRIPT-160112-857
Transcript Name: emc4-202
Previous Name: emc4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000062953 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000062953|OTTDARG00000043386| emc4|OTTDARP00000049214 emc4-001 LG_1 none CABZ01101003.1,CABZ01079073.1,CU905505.4 Danio rerio protein_coding KNOWN, 346 bp
CGTTTAAGCTGCTGGAGAGCTCCAGTCAGCAGTGGCTGCA
GGGTCTGGTCTACCTCATCGGGAACCTGCTGGGCTCCGCA
TTGGCCATCTACAAGTGTCAATCAATGGGGCTCCTCCCCA
CGCACTCCTCTGATTGGCTGGCATTCATCGAGCCGCCGCA
GAGGCTGGAGATCATGGGCGGAGGGATGGTCATGTGACGC
GCACACACACACACACACACACACACACTGTTATTTAACG
TCAGCATTTTAACCGCACACACTGATGATTAATTTATATT
TGTGATTTGTGTTAGCAGAGGTCTGATTAATAACGTGCAT
TAAACTAATAAAGATTCTTTAACATG

emc4 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA emc4-202 346
ncRNA emc4-002 (1) 176
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
emc4-202 Contained in:
[Fosmid] ZFOS-405G10 (1)

Genome Resources: Vega_Trans:OTTDART00000062953 (1),  Ensembl_Trans:ENSDART00000173433 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC065880 (1) 965 nt
GenBank:EE331359 (1) 867 nt
CITATIONS (2)