Transcript

emc4-002

ID
ZDB-TSCRIPT-160112-540
Name
emc4-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000062952 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000062952|OTTDARG00000043386| emc4|no_translation emc4-002 LG_1 none CABZ01101003.1,CABZ01079073.1,CU905505.4 Danio rerio protein_coding KNOWN, 176 bp
CGGTTGCGCTTCCTGTGGAGAGCTAATGCACAGTTTCTGC
TGTCGCGTTCTTTAATCTAGTCGATATTTAAAAACAATCC
TGCTTATAAACTCTGCAGACGGACTAAAATCTGGCAGATT
GTGTTTAAAACACCCTGGCTGATCTTCTTCTTCTGCTGTT
AGACGAGCGCTGAGAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations