header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-160112-844
Transcript Name: ubl3b-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000062914 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000062914|OTTDARG00000020982| ubl3b|no_translation ubl3b-003 LG_ CT573152.12 Danio rerio protein_coding KNOWN, 919 bp
GTTATGTGGGGTGAGCGCAGATTGAAGGGTCATTAAAAAG
GTCTATTTGGTGGAAATGTCACCGTGGCTCTGGCTTGTAG
GGCACTTCTTCACTGTTTAATGGTTTCATTTGTTTCGTCT
GGTTACAGGTGAACCTACGGCTGATCCTCGTGAGTGGGAA
GACCCAGGATTTCACTTTTTCTCCCAATGACTCTGCCACA
GACATTGCCCGTCATGTTTTTGAAAACTGGCCAGCCGGCT
GGGAGGAGGAGAGCGTGAGCAGTCCCAGCATCCTCAGGCT
GATCTTCCAGGGTCGCTTCCTGCATGGCAATGTCACACTA
GGAGCTCTGAAGTTGCCCCCTGGCCGAACAACTGTCATGC
ACTTGGTTGCAAGAGAGACTCTGCCAGAGCCCAACTCCCA
TGGCCAGAGGAACAGGGAGAAAACCACAGAGAGCAGCTGC
TGTCTACTGCTGTAAAACCCAGACCAAGCGCCCCCTCCTC
CTCCTCCTCCTTCTGCTCCCGCTCCGTCTCTCTGCTCACC
AACCCGTGGTGCATTCTGGATGATTACAGAAGAGCTCCAG
GGACAATGTGACTAGGTTTTCATTCAGTGTTTTTTTTTGT
TCGCTCTGTATAGTAGATGGAGACTCTCTTTGTGCCAAGT
ATATCAGATCTCCTATTTGCCTTGGTTTGGTTTTCTCGTT
TCATTCGGTTGCCAAAATTGCGTTCTTCTGTTTAGTAAAG
TGGCCCTTTGTTTACAGGCCTCCTGCAAAAATATGAACTA
CTGTTAAAATTGCGTAACCAATATCTGAACAGGTTTTCAG
GGGGACGTCCTGTACTCGAGAGCTCAACACCCGAGCGTCA
GAGTTTTCACTTGGCATCGCACGTCTGACTCAGACCAAGC
TTAACATGCGTCATAATCTCAAGACTTTTTGATTGCACT

ubl3b TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA ubl3b-002 (1) 853
ubl3b-003 919
mRNA ubl3b-201 (1) 2458
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ubl3b-003 Contained in:

OTHER ubl3b-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000062914 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EE698864 (1) 916 bp
    CITATIONS (1)