ZFIN ID: ZDB-TSCRIPT-160112-840
Transcript Name: mmgt1-203
Previous Name: mmgt1-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000062902 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000062902|OTTDARG00000021157| mmgt1|OTTDARP00000049173 mmgt1-003 LG_ BX511227.7 Danio rerio protein_coding KNOWN, 564 bp
AAACGATCACGCCTTTCCTCTCACCGTATATCATCGCCAG
TCCAGTCTCGTGCAGAAACCTGAAGCGGCGGTGCTTGAAC
AGCCATATGACCGATCCTACATGAGACTGACAGAAAAGGA
GAACGAAACATTACCAATAGATATAGTGTTACAGACGTTG
TTATCATTTGTGATCACGTGTTATGGCATCGTGCACATCT
CAGGCGAGTTTAAAGACATGGACGCGTCCTCAGAGCTCAA
AAACAAGACATTTGACACATTGAGAAATCACCCATCATTC
TACCTGTTCAATCACCGAGGCAGAGTTCTCTTCCGCACTC
CAGAACAAGAGCCATCCACTCCAAACGCCCAGGCCTTGCC
CTCCAATCCCCTGCGGTTACGCAAGCTGGAAAACTTTCAT
TAAGACTGGCCTTCAGTGGGCTGCCTTGCCCGTTATTCTT
TGTTTTTTTTGGTGAATTTATTTGTTAGCTCCTCAGTTGG
AAGGAAGGGAAAATCCGCATCTTTTCCTGTCTTCATGTAT
ATGTGAATATGCTGTACAAACATGCATCTCTTGTGGTTAC
TACT

mmgt1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA mmgt1-201 (1)    Ensembl 1145
mmgt1-203 564
ncRNA mmgt1-002 (1)    Ensembl 762
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mmgt1-203 Contained in:

Genome Resources: Vega_Trans:OTTDART00000062902 (1),  Ensembl_Trans:ENSDART00000173277 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AW305904 (1) 565 nt
GenBank:CD593487 (1) 340 nt
GenBank:CD588547 (1) 310 nt
CITATIONS (2)