ZFIN ID: ZDB-TSCRIPT-090929-9396
Transcript Name: mmgt1-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026781 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026781|OTTDARG00000021157|ZDB-GENE-040801-65 mmgt1|no_translation mmgt1-002 LG_ BX511227.7 Danio rerio protein_coding KNOWN, 762 bp
TCCTACATGAGACTGACAGAAAAGGAGAACGAAACATTAC
CAATAGATGTAAGTTGCGAAACAGAAAACGCTTCTCATAC
TAAATCACATTGATTTGTCGTTCTCCTCCTCAAGTCAGCT
TCTCTTGTGTTGTGTTTGCAGATAGTGTTACAGACGTTGT
TATCATTTGTGATCACGTGTTATGGCATCGTGCACATCTC
AGGCGAGTTTAAAGACATGGACGCGTCCTCAGAGCTCAAA
AACAAGACATTTGACACATTGAGAAATCACCCATCATTCT
ACCTGTTCAATCACCGAGGCAGAGTTCTCTTCCGCACTCC
AGAACAAGAGCCATCCACTCCAAACGCCCAGGCCTTGCCC
TCCAATCCCCTGCGGTTACGCAAGCTGGAAAACTTTCATT
AAGACTGGCCTTCAGTGGGCTGCCTTGCCCGTTATTCTTT
GTTTTTTTTGGTGAATTTATTTGTTAGCTCCTCAGTTGGA
AGGAAGGGAAAATCCGCATCTTTTCCTGTCTTCATGTATA
TGTGAATATGCTGTACAAACATGCATCTCTTGTGGTTACT
ACTTTGTCAATGGACTGTGCCAACTCCTTTTTCCAGCTGA
TATGTCTGTAAATACTTGTTATTGCTTTGGAGTCTTAAGT
CTATAGGTTACAGCCGTCGCACACAGCAGGGCACGAATCC
TATCATGTACATTGTTGGTTTGGCACATTTCTGGCTGAAC
TGAACTTAACTGCGGCAGGTTCTTCCCTGTACCCTTCTGA
AT

mmgt1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA mmgt1-201 (1)    Ensembl 1145
mmgt1-203 (1)    Ensembl 564
ncRNA mmgt1-002 762
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mmgt1-002 Contained in:

Genome Resources: Vega_Trans:OTTDART00000026781 (1),  Ensembl_Trans:ENSDART00000138434 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CT715758 (1) 787 nt
CITATIONS (2)