ZFIN ID: ZDB-TSCRIPT-160112-750
Transcript Name: pdzd3b-201
Previous Name: pdzd3b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000062619 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000062619|OTTDARG00000043237| pdzd3b|OTTDARP00000048963 pdzd3b-001 LG_ BX294376.10 Danio rerio protein_coding KNOWN, 1976 bp
GGTGTGTTTTGTCCCGTTGCTTGTTCCTCATCTCCCTCAT
GACTTCAGTTGCAGTGCTGCTGGATGCAATGGAGCTGACG
AAGAAGTTTACCTTCAATCCCAAGAAAGGAATAGACAATC
CAGTCATGGTTACTGCAGATGAAACAGAGCGAGTGTGGAA
CCCCACGCCCCGTGTGTGTGTGCTGAGGAGGGAAGAAAAA
GAAACCTTTGGCTTCCACCTGCGTGTGGAGAGAGATCGAC
AGGGTCACGTCATCCGCCTGCTGGACTCACCGGGCCCGGC
GGCACGGAGCGGCCTCAAAGATGGAGACCGTCTGCTGGAG
GTCAATGAGGTGTTTGTGGAAAACTTGGAGCACACAGAGG
TGAGCGGATCACAGATATGTTTTCTGGTGCTGGATGAAAA
GGCCTATGAGCAGGTAGTGTCTGAGGGACGTGATCTCCGA
GAGATGGCTAAAGCCGCCCGTGGAGAAGGATGGAGGCCAC
CTCGTCTTTGCCACATCAGGAAAGATGCACATGGCATGGG
ATTCAACATACTGCCGGTGGAAGGTGAGAAAGGGAAATTC
GCAGTGAGCCCAGTTAAAAGAGGTGCTGCCGAGAGGGCAG
GAGTGAGGAAAGGAGACCACTTAATCTGGATTGATGGTGC
CATGGCCTCTGAACTCACACATTCTGCCATCAGCAAAATG
GTGAAAAAGTGCAGCAGTCACATGACAGTGCTGGTGATTG
ACAGTGACACTGAGAAGAGTTATGCCCGCCGCAAAATGCC
AATTCTCCCAGCCATGGCTGATGCAGAAAAAATGCCGTAT
CGGCCTCAGAGACTGCATCTGGTGATGGGGCCTGATGGAT
ACGGCTTTCTGCTCAGACAGGAGAAGGGTGGAGCTGGACG
CACCGTTCACATGGTGAGAGAGGTGGATAAGGGCAGCCCT
GCTGAACTGGGAGGAGTCAAAGAAGGTGAGATGCTTCTTG
AAGTGAATGGAGAGTCCACAGACCCACTGAGCCATGAAGA
TGTTGTCAGCAATATCCGACAAAGTGGACAGCAGGTCACC
CTAACTACGATGACACCTCAGGGTTATGACTTCTACACTA
AGTTGGGTCTCTCTCCCTTGCTGTTCTGTGTGGATGTCCC
ATCTGCCATCCCTGAGGTAAAAAAGGAAATCCCAGTGACG
CCAAAGCCTGCAGTGCCTCCTGTTGAGCCTCAGGAGGAGG
TGCAGATCAACCCTAATGTTAGACGCTGTATACTGGAGAG
GGGCTCGGCTGGTTTTGGCTTCCATTTGGGCTGCGTCCAA
CAGAAACCTGGCACCTTCATCAGCCAGGTAGCGGCAGGCG
GTCCAGGACAGAGTTCAGGTCTCTTTCAAGGTGATGTGGT
GGTGGAGGTGAACGGACAAAATGTGGAGAAAGAGTCTTTG
GAGGATGTGATCATGCATGTGAAGAGAGGAGGAGAAACCC
TTTCTTTACTGGTCGTTGATCAAAAAGGTTATGATTGGCT
GAAGCAGAACGGGAAGCCAGTCACACTAAACAAATTAGAA
ACAATCTCTGAGGTGGAGGAAAGTGTTTCAAGTTCTGCTG
AACCAGCAAGAGTGAAGACCGGTGACTCTGATGGCCAGAC
TTTGTCCATTTAGTTTCATTTAGGATGAGCATTTAAACAG
ACCTGATATTGTCCATTAGATCGATGCATTGAGGATGAGG
AATAAACAGAGATCCACTGGTTGGCTAATTTCTCTGACCA
ATAGCCATACTACACTTTGCACTTTGCCGTTTTTAACGAT
TGGAAACACTCACAATTTTGAGAGCATATGTGTGTCTGAA
TAGTTAAATCAGTATGACTGTGGCATAAAGACATTTATTT
ATGTGTCTCTGAGAAGTATTATTTCTTTGATATTACTGTT
GTATTCACTATGTTTTTGCCAGGTTATGACCTTTATGAGT
TATGAAACTATTTAAGCATTGTATCATTTCATCCTGAATA
AAGTATGATTAAAATG

pdzd3b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA pdzd3b-201 1976
pdzd3b-202 (1)    Ensembl 551
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pdzd3b-201 Contained in:
[BAC] CH211-117M20 (1)

Genome Resources: Vega_Trans:OTTDART00000062619 (1),  Ensembl_Trans:ENSDART00000078049 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC163387 (1) 1680 nt
CITATIONS (2)