Transcript

pdzd3b-201

ID
ZDB-TSCRIPT-160112-750
Name
pdzd3b-201
Previous Names
  • pdzd3b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000062619 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000062619|OTTDARG00000043237| pdzd3b|OTTDARP00000048963 pdzd3b-001 LG_ BX294376.10 Danio rerio protein_coding KNOWN, 1976 bp
GGTGTGTTTTGTCCCGTTGCTTGTTCCTCATCTCCCTCAT
GACTTCAGTTGCAGTGCTGCTGGATGCAATGGAGCTGACG
AAGAAGTTTACCTTCAATCCCAAGAAAGGAATAGACAATC
CAGTCATGGTTACTGCAGATGAAACAGAGCGAGTGTGGAA
CCCCACGCCCCGTGTGTGTGTGCTGAGGAGGGAAGAAAAA
GAAACCTTTGGCTTCCACCTGCGTGTGGAGAGAGATCGAC
AGGGTCACGTCATCCGCCTGCTGGACTCACCGGGCCCGGC
GGCACGGAGCGGCCTCAAAGATGGAGACCGTCTGCTGGAG
GTCAATGAGGTGTTTGTGGAAAACTTGGAGCACACAGAGG
TGAGCGGATCACAGATATGTTTTCTGGTGCTGGATGAAAA
GGCCTATGAGCAGGTAGTGTCTGAGGGACGTGATCTCCGA
GAGATGGCTAAAGCCGCCCGTGGAGAAGGATGGAGGCCAC
CTCGTCTTTGCCACATCAGGAAAGATGCACATGGCATGGG
ATTCAACATACTGCCGGTGGAAGGTGAGAAAGGGAAATTC
GCAGTGAGCCCAGTTAAAAGAGGTGCTGCCGAGAGGGCAG
GAGTGAGGAAAGGAGACCACTTAATCTGGATTGATGGTGC
CATGGCCTCTGAACTCACACATTCTGCCATCAGCAAAATG
GTGAAAAAGTGCAGCAGTCACATGACAGTGCTGGTGATTG
ACAGTGACACTGAGAAGAGTTATGCCCGCCGCAAAATGCC
AATTCTCCCAGCCATGGCTGATGCAGAAAAAATGCCGTAT
CGGCCTCAGAGACTGCATCTGGTGATGGGGCCTGATGGAT
ACGGCTTTCTGCTCAGACAGGAGAAGGGTGGAGCTGGACG
CACCGTTCACATGGTGAGAGAGGTGGATAAGGGCAGCCCT
GCTGAACTGGGAGGAGTCAAAGAAGGTGAGATGCTTCTTG
AAGTGAATGGAGAGTCCACAGACCCACTGAGCCATGAAGA
TGTTGTCAGCAATATCCGACAAAGTGGACAGCAGGTCACC
CTAACTACGATGACACCTCAGGGTTATGACTTCTACACTA
AGTTGGGTCTCTCTCCCTTGCTGTTCTGTGTGGATGTCCC
ATCTGCCATCCCTGAGGTAAAAAAGGAAATCCCAGTGACG
CCAAAGCCTGCAGTGCCTCCTGTTGAGCCTCAGGAGGAGG
TGCAGATCAACCCTAATGTTAGACGCTGTATACTGGAGAG
GGGCTCGGCTGGTTTTGGCTTCCATTTGGGCTGCGTCCAA
CAGAAACCTGGCACCTTCATCAGCCAGGTAGCGGCAGGCG
GTCCAGGACAGAGTTCAGGTCTCTTTCAAGGTGATGTGGT
GGTGGAGGTGAACGGACAAAATGTGGAGAAAGAGTCTTTG
GAGGATGTGATCATGCATGTGAAGAGAGGAGGAGAAACCC
TTTCTTTACTGGTCGTTGATCAAAAAGGTTATGATTGGCT
GAAGCAGAACGGGAAGCCAGTCACACTAAACAAATTAGAA
ACAATCTCTGAGGTGGAGGAAAGTGTTTCAAGTTCTGCTG
AACCAGCAAGAGTGAAGACCGGTGACTCTGATGGCCAGAC
TTTGTCCATTTAGTTTCATTTAGGATGAGCATTTAAACAG
ACCTGATATTGTCCATTAGATCGATGCATTGAGGATGAGG
AATAAACAGAGATCCACTGGTTGGCTAATTTCTCTGACCA
ATAGCCATACTACACTTTGCACTTTGCCGTTTTTAACGAT
TGGAAACACTCACAATTTTGAGAGCATATGTGTGTCTGAA
TAGTTAAATCAGTATGACTGTGGCATAAAGACATTTATTT
ATGTGTCTCTGAGAAGTATTATTTCTTTGATATTACTGTT
GTATTCACTATGTTTTTGCCAGGTTATGACCTTTATGAGT
TATGAAACTATTTAAGCATTGTATCATTTCATCCTGAATA
AAGTATGATTAAAATG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations