Transcript

pdzd3b-202

ID
ZDB-TSCRIPT-160112-116
Name
pdzd3b-202
Previous Names
  • pdzd3b-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000062620 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000062620|OTTDARG00000043237| pdzd3b|OTTDARP00000048964 pdzd3b-002 LG_ BX294376.10 Danio rerio protein_coding KNOWN, 551 bp
AGCGAGTGTGGAACCCCACGCCCCGTGTGTGTGTGCTGAG
GAGGGAAGAAAAAGAAACCTTTGGCTTCCACCTGCGTGTG
GAGAGAGATCGACAGGGTCACGTCATCCGCCTGCTGGACT
CACCGGGCCCGGCGGCACGGAGCGGCCTCAAAGATGGAGA
CCGTCTGCTGGAGGTCAATGAGGTGTTTGTGGAAAACTTG
GAGCACACAGAGGTGGCCCGTTGGATACAGGTGAGCGGAT
CACAGATATGTTTTCTGGTGCTGGATGAAAAGGCCTATGA
GCAGGTAGTGTCTGAGGGACGTGATCTCCGAGAGATGGCT
AAAGCCGCCCGTGGAGAAGGATGGAGGCCACCTCGTCTTT
GCCACATCAGGAAAGATGCACATGGCATGGGATTCAACAT
ACTGCCGGTGGAAGGTGAGAAAGGGAAATTCGCAGTGAGC
CCAGTTAAAAGAGGTGCTGCCGAGAGGGCAGGAGTGAGGA
AAGGAGACCACTTAATCTGGATTGATGGTGCCATGGCCTC
TGAACTCACACATTCTGCCATCAGCAAAATG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations