ZFIN ID: ZDB-TSCRIPT-160112-116
Transcript Name: pdzd3b-202
Previous Name: pdzd3b-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000062620 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000062620|OTTDARG00000043237| pdzd3b|OTTDARP00000048964 pdzd3b-002 LG_ BX294376.10 Danio rerio protein_coding KNOWN, 551 bp
AGCGAGTGTGGAACCCCACGCCCCGTGTGTGTGTGCTGAG
GAGGGAAGAAAAAGAAACCTTTGGCTTCCACCTGCGTGTG
GAGAGAGATCGACAGGGTCACGTCATCCGCCTGCTGGACT
CACCGGGCCCGGCGGCACGGAGCGGCCTCAAAGATGGAGA
CCGTCTGCTGGAGGTCAATGAGGTGTTTGTGGAAAACTTG
GAGCACACAGAGGTGGCCCGTTGGATACAGGTGAGCGGAT
CACAGATATGTTTTCTGGTGCTGGATGAAAAGGCCTATGA
GCAGGTAGTGTCTGAGGGACGTGATCTCCGAGAGATGGCT
AAAGCCGCCCGTGGAGAAGGATGGAGGCCACCTCGTCTTT
GCCACATCAGGAAAGATGCACATGGCATGGGATTCAACAT
ACTGCCGGTGGAAGGTGAGAAAGGGAAATTCGCAGTGAGC
CCAGTTAAAAGAGGTGCTGCCGAGAGGGCAGGAGTGAGGA
AAGGAGACCACTTAATCTGGATTGATGGTGCCATGGCCTC
TGAACTCACACATTCTGCCATCAGCAAAATG

pdzd3b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA pdzd3b-201 (1)    Ensembl 1976
pdzd3b-202 551
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pdzd3b-202 Contained in:
[BAC] CH211-117M20 (1)

Genome Resources: Vega_Trans:OTTDART00000062620 (1),  Ensembl_Trans:ENSDART00000172886 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)