Transcript

slc6a1b-002

ID
ZDB-TSCRIPT-160112-711
Name
slc6a1b-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000062497 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000062497|OTTDARG00000043159| slc6a1b|no_translation slc6a1b-002 LG_none CU633837.8,FQ482078.1 Danio rerio protein_coding KNOWN, 645 bp
CACGTACCCCTATTTCATGCTCTTTATCCTGTTCATCCGT
GGAGTGACGCTGCCGGGGGCCAAAGAGGGCATTTTATTCT
ACGTGACGCCTGAGTTCAGCAAACTGAAGGAATCAGAGGT
GTGGCTGGACGCCGCCACGCAGATCTTCTTCTCGTACGGT
TTGGGTCTGGGCTCGCTCATCGCCCTCGGGAGCTACAACC
CCTTCAACAATAACGTTTACAAAGACTCCATCATCGTCTG
CTGCATTAATTCCTTCACCAGTATGTTCGCCGGATTCGTC
ATTTTCTCCATCGTTGGCTTCATGGCGCACATCACAAAAC
GACCCATCGCAGACGTGGCGGCATCAGGTGACCATCAGGG
GTTCAGATCCATCACTGATAACATGAGTTTTCACAGTATT
TCCTTTAATGTTTGTTCTTCTGGAGAAATCTGATTTGTTT
TAAGCTAGAATAAAAGCAGTTTTTAATTTATTTAATCCAT
GTTAAGGTCAATATTATTCACCCCTTCAGCAATATTAGTG
TTGGATAGTCTCCAGAACAAACCACTGTTATACAATGACT
TGCCTAATTACCCTAACCTTACCCTAGCTAAGCCAGGGTT
ACAGCTGAAATCTGGAGGACGGTGGATCTCTGTCCTAGTG
TGTGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations