Transcript

il17rd-201

ID
ZDB-TSCRIPT-160112-681
Name
il17rd-201
Previous Names
  • il17rd-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000062401 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000062401|OTTDARG00000036376| il17rd|OTTDARP00000048776 il17rd-002 LG_none CU459189.8,FO704603.1 Danio rerio protein_coding KNOWN, 2984 bp
CGTTCACTGAGCTCCACCTTGCGTCTCGTGCACGCTCACA
GACTCGCGAGCGTTCATTCACTTCAGAGGAGCTTCATGGA
CGGACAGGAATGGCTGGGTCACGGAGACTTGCGCATTTTT
TCATGGCTTCATGCTTATTTCTGTGCTACACCGCTTCGGT
GAACGGAGGAAAGAGAGGAAACTCGGATAAATGCAGCTAT
AAGGGAACACAGACGTCCAGCATGGATGAGGGCGCTCGCA
AACTCGGAGTCACATTTCGATATGACAACTGCTCTGTGAA
CTGGAGTCCGCTGGGGAAACACGCCATCCATGAAGTGAAC
AACATCAGCTTCAGTCATCTGTCCTGTGACAGCCAAGCAG
CCGTGGTGGTCCATTGGATGGCCAGTCCTCTCGGTATTGA
ACATGTGAAGGGATTCAGAGTGTATCTGGAGGACAAAAAC
CCAGAGCGGAAACAATGCCAACACTTGATCCTGAAGGATC
CGCGACAGCTCAACTTCTCTTACAAAACCATCAGGATGAG
CTCACAGCCCTTCTCAAGTCTCGCCTTCGAGACCGATTAC
ATGGTCAGAATTGTGCCGTTTCCAACTTTCTTGAACGACA
GCTTCTTTCCGCCATCTTTTCTGCGCACTAACAGTTGTGA
AGTCCTTCTTGGCCCAGATAACCTCGTCTGCAAACCATTC
TGGAAGCCCAAGATGCTGAACGTTTCTCAGCTGGGATCTA
ATTTGCATGTTGTGTTTGACCACGCCCCCTCCACCTTCGG
CTTCTCCATTTACTACCTGTACTACAAACTCAGACAGGAA
GGACCGTTCAGACTCAAGCGCTGCAAACCTGAGCAAAACG
GCCCCAAAACTACTTGTGTTTTACAAGATGTCACTCCAGG
AACGTATGCAATCGAGCTTCGTGATGACAGCAACAACACC
AGAAGACAGACACAGTATCACGTCAGCCAAGTTCACTCCC
CGTGGGCCGGGCCGATCCGTGCCATGGCCATCACCGTCCC
GCTGGTCATCATGTCAGCCTTCGCCACACTCTTCACCGTC
ATGTGCCGCAAGAAACAGCAAGAAAACATCTACTCTCACC
TGGACGAGGAGAGCTCGGAGTCTTCATCGCAGACCACGGC
TCTGAGCGCAGACAGACCCTGGCCCAGACCCAAAATCTTC
ATCTGTTACTCCAGCAGAGACGGAGCCAAACACCTCGCCG
TCATCCAGAGCTTCGCCTTCTTCCTGCAGGACTTCTGCGG
CTGCGAGGTTTCTCTGGACCTCTGGGAGCACCTGGAGATC
TGTAAGGAGGGTCAGATGTCCTGGTTGAGCCGGCGCATCG
ACGAAGCCCACTTCATCATCACCGTCTGCTCCAAAGGCCT
GAAGCACTTCGTGGAGAAACGCCACCGCAAAGGCAAAGCC
ACATCCAAAGAGAAAAACCGAGAGCCGAGCGCTAGCGACT
CCAGCAGCAGCAGCAGAGATCTGTTCATCGTGGCCTCCGC
CATCATCTCAGAGAAACTCAAAGAAGTGCACCAGAAATCC
TCCGACCTGTCGCGCTTCATGTCTGTGTATTTCGATTATT
CCCATGAAACCGATGTCCCGACTTCACTCAGCCTGGCGCC
GAAGTTTAAGCTGATGGATCAGCTGCCGCAACTCTTCGCC
CGATTGCATTCGCGCCAACTGAGTTTGACCGATCGTGAAC
CACAGCCGCCGAATGTTAGCAAACGCAACTACTTCTGCAG
CAAATCGGGGCGCTCGTTATATGTTGCAATTTATAACATG
CATCAGTACGTCACGCAGGAGCCTGATTGGCTGGAGAAGG
AACTCATGCCTCCGCCGCTGCCTAATAAACGCACCATTCC
TGAAAAAGTAGATTCAGGATTGGTGCTAAATGAAGTCAAA
CTCAAGCATGGGTCAGAAAGCGAGTGTCCTCCAGTGAGGA
GTAACGTTTTGATTTTGCCGCAGACGCCTCAGGTGGGAGT
GTCTTTGAGTTTGTCGAGAGAGGATCTCGGGGAGGGATCG
TCCAGTCAGGACGCGGGTTCATGCCGGCCGGTTCTTCACA
CTGACGGATCCGCCAGTCCGCCGGAGATGCCCAGAGATTC
GGGGATTTACGATTCATCTGTGCCGTCGTCAGAGCTCTCC
ATCCCGCTGATGGACGGACTCTCACCGGATCACGCAGATA
ACTCGTCTTTGGCTGACAGCGTGTCCTCCTCTTCAGGACT
GGGTGACGAGGAGCCTCCAGCCGTCAGCTCACTGCACTGC
ACAGCACACACAATATGCAAAGCAGATCTCCATCATCAGC
ACCTCCACCCGAGTGAAGGACTCATAGCTGCAGCCTCCAC
CTGATGCCTTCAGCTCCACTCGCAGCGCCACTTTAACCCT
TTTCCTGCCACTGACTCATGCGTCAATGAATCTCTTCATC
CGGAGACACATCTAATGGAGTAATCTAAAGGGATCTGGCA
ACGCTGTGTCTGAAAAACTGAACCAAAGTGCTATGGATAT
GCTATCGTCATTCAGACCTTCTTGCCTTAAAATGGGTTTG
AACCTGTGGACGGACCTGAATGTGAGAGTCCTTTAACATG
TAATTTCAGCTTTATTTATTGTATTAACTGGCTTCAGATG
TGCGGGATAACCTGTTGTGCTCACTGCAGATGTGTAGATT
GGGACTTTTTACATAGCAACACTCAGTTTTAGAGGCGTTT
CAGGAGCTTTTAGGTCTTTATTTTTGTTTATGGATCTTTA
AAAACGTTTCGGAAATGTTCACCGCATAGCATAAACAGAT
TAGCATAGGTCTAATGTTTGCTTTATGACAAAGGGAAGAA
TGAGATGCTATTTTGTTAACTTTATAAATGTAAATGTTTC
ATCTGTGTACGGTTTTATCCAGGTTTTGTACAGTTTTTTA
GTATATTAGGAGTGATTTCTACATTATATAAGCTTTGTAC
TGTTTTATAGTACTCTAATGTAGGAGGTACACAATAAAAC
TAAGATTTATATGCATTGTGTACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations