Transcript

il17rd-202

ID
ZDB-TSCRIPT-131113-315
Name
il17rd-202
Previous Names
  • il17rd-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000051795 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000051795|OTTDARG00000036376|ZDB-GENE-020320-5 il17rd|OTTDARP00000046484 il17rd-001 LG_none CU459189.8,FO704603.1 Danio rerio protein_coding KNOWN, 2932 bp
ATTCACTTCAGAGGAGCTTCATGGACGGACAGGAATGGCT
GGGTCACGGAGACTTGCGCATTTTTTCATGGCTTCATGCT
TATTTCTGTGCTACACCGCTTCGGTGAACGGAGGAAAGAG
AGGAAACTCGGATAAATGCAGCTATAAGCAGGGAACACAG
ACGTCCAGCATGGATGAGGGCGCTCGCAAACTCGGAGTCA
CATTTCGATATGACAACTGCTCTGTGAACTGGAGTCCGCT
GGGGAAACACGCCATCCATGAAGTGAACAACATCAGCTTC
AGTCATCTGTCCTGTGACAGCCAAGCAGCCGTGGTGGTCC
ATTGGATGGCCAGTCCTCTCGGTATTGAACATGTGAAGGG
ATTCAGAGTGTATCTGGAGGACAAAAACCCAGAGCGGAAA
CAATGCCAACACTTGATCCTGAAGGATCCGCGACAGCTCA
ACTTCTCTTACAAAACCATCAGGATGAGCTCACAGCCCTT
CTCAAGTCTCGCCTTCGAGACCGATTACATGGTCAGAATT
GTGCCGTTTCCAACTTTCTTGAACGACAGCTTCTTTCCGC
CATCTTTTCTGCGCACTAACAGTTGTGAAGTCCTTCTTGG
CCCAGATAACCTCGTCTGCAAACCATTCTGGAAGCCCAAG
ATGCTGAACGTTTCTCAGCTGGGATCTAATTTGCATGTTG
TGTTTGACCACGCCCCCTCCACCTTCGGCTTCTCCATTTA
CTACCTGTACTACAAACTCAGACAGGAAGGACCGTTCAGA
CTCAAGCGCTGCAAACCTGAGCAAAACGGCCCCAAAACTA
CTTGTGTTTTACAAGATGTCACTCCAGGAACGTATGCAAT
CGAGCTTCGTGATGACAGCAACAACACCAGAAGACAGACA
CAGTATCACGTCAGCCAAGTTCACTCCCCGTGGGCCGGGC
CGATCCGTGCCATGGCCATCACCGTCCCGCTGGTCATCAT
GTCAGCCTTCGCCACACTCTTCACCGTCATGTGCCGCAAG
AAACAGCAAGAAAACATCTACTCTCACCTGGACGAGGAGA
GCTCGGAGTCTTCATCGCAGACCACGGCTCTGAGCGCAGA
CAGACCCTGGCCCAGACCCAAAATCTTCATCTGTTACTCC
AGCAGAGACGGAGCCAAACACCTCGCCGTCATCCAGAGCT
TCGCCTTCTTCCTGCAGGACTTCTGCGGCTGCGAGGTTTC
TCTGGACCTCTGGGAGCACCTGGAGATCTGTAAGGAGGGT
CAGATGTCCTGGTTGAGCCGGCGCATCGACGAAGCCCACT
TCATCATCACCGTCTGCTCCAAAGGCCTGAAGCACTTCGT
GGAGAAACGCCACCGCAAAGGCAAAGCCACATCCAAAGAG
AAAAACCGAGAGCCGAGCGCTAGCGACTCCAGCAGCAGCA
GCAGAGATCTGTTCATCGTGGCCTCCGCCATCATCTCAGA
GAAACTCAAAGAAGTGCACCAGAAATCCTCCGACCTGTCG
CGCTTCATGTCTGTGTATTTCGATTATTCCCATGAAACCG
ATGTCCCGACTTCACTCAGCCTGGCGCCGAAGTTTAAGCT
GATGGATCAGCTGCCGCAACTCTTCGCCCGATTGCATTCG
CGCCAACTGAGTTTGACCGATCGTGAACCACAGCCGCCGA
ATGTTAGCAAACGCAACTACTTCTGCAGCAAATCGGGGCG
CTCGTTATATGTTGCAATTTATAACATGCATCAGTACGTC
ACGCAGGAGCCTGATTGGCTGGAGAAGGAACTCATGCCTC
CGCCGCTGCCTAATAAACGCACCATTCCTGAAAAAGTAGA
TTCAGGATTGGTGCTAAATGAAGTCAAACTCAAGCATGGG
TCAGAAAGCGAGTGTCCTCCAGTGAGGAGTAACGTTTTGA
TTTTGCCGCAGACGCCTCAGGTGGGAGTGTCTTTGAGTTT
GTCGAGAGAGGATCTCGGGGAGGGATCGTCCAGTCAGGAC
GCGGGTTCATGCCGGCCGGTTCTTCACACTGACGGATCCG
CCAGTCCGCCGGAGATGCCCAGAGATTCGGGGATTTACGA
TTCATCTGTGCCGTCGTCAGAGCTCTCCATCCCGCTGATG
GACGGACTCTCACCGGATCACGCAGATAACTCGTCTTTGG
CTGACAGCGTGTCCTCCTCTTCAGGACTGGGTGACGAGGA
GCCTCCAGCCGTCAGCTCACTGCACTGCACAGCACACACA
ATATGCAAAGCAGATCTCCATCATCAGCACCTCCACCCGA
GTGAAGGACTCATAGCTGCAGCCTCCACCTGATGCCTTCA
GCTCCACTCGCAGCGCCACTTTAACCCTTTTCCTGCCACT
GACTCATGCGTCAATGAATCTCTTCATCCGGAGACACATC
TAATGGAGTAATCTAAAGGGATCTGGCAACGCTGTGTCTG
AAAAACTGAACCAAAGTGCTATGGATATGCTATCGTCATT
CAGACCTTCTTGCCTTAAAATGGGTTTGAACCTGTGGACG
GACCTGAATGTGAGAGTCCTTTAACATGTAATTTCAGCTT
TATTTATTGTATTAACTGGCTTCAGATGTGCGGGATAACC
TGTTGTGCTCACTGCAGATGTGTAGATTGGGACTTTTTAC
ATAGCAACACTCAGTTTTAGAGGCGTTTCAGGAGCTTTTA
GGTCTTTATTTTTGTTTATGGATCTTTAAAAACGTTTCGG
AAATGTTCACCGCATAGCATAAACAGATTAGCATAGGTCT
AATGTTTGCTTTATGACAAAGGGAAGAATGAGATGCTATT
TTGTTAACTTTATAAATGTAAATGTTTCATCTGTGTACGG
TTTTATCCAGGTTTTGTACAGTTTTTTAGTATATTAGGAG
TGATTTCTACATTATATAAGCTTTGTACTGTTTTATAGTA
CTCTAATGTAGGAGGTACACAATAAAACTAAGATTTATAT
GCATTGTGTACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations