Transcript

adamts17-202

ID
ZDB-TSCRIPT-160112-613
Name
adamts17-202
Previous Names
  • adamts17-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000063182 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000063182|OTTDARG00000043559| adamts17|OTTDARP00000049414 adamts17-001 LG_1 none CABZ01086829.1,CABZ01086828.1,CABZ01072251.1,CABZ01072252.1,CABZ01072253.1,CABZ01029507.1,CABZ01029508.1,CABZ01029509.1,CABZ01029510.1,CABZ01029511.1,CABZ01029512.1,CABZ01029513.1,CABZ01029514.1,CABZ01029515.1,CABZ01029516.1,CABZ01029517.1,CABZ01029518.1,CABZ01029519.1,CU184872.16 Danio rerio protein_coding KNOWN, 2891 bp
AACTGTAACTCTGTGCTTTGTTTTCTCCTCAGGAATCGCG
TATCTGGGCGGCACCTGTAGCTCCAAGAGGAAGTGTGTGC
TGGCGGAGGACAACGGACTCAACCTGGCCTTCACCATCGC
TCATGAGCTCGGACACAACATGGGCATGAGCCATGATGAT
GATCATGCCAGCTGCACTGGCCACTCTCACATCATGTCTG
GCGAATGGGTGAAAGGGCGTAACCCCAGCGACCTCTCCTG
GTCCACCTGCAGTCGGGATGACCTGGAGAAGTTCCTCAGG
TCTAAAGCCAGTGGTTGTTTGCTGCACACTGATCCCCGTA
ACCGATATCTCGTCCGTCTGCCAGCCAAACTGCCCGGGAT
GCACTACAGCGCTGATGAGCAGTGCCAGATCCTGTTCGGC
ACCAACGCCACTTTCTGCACTGATATGGAGCACCTGATGT
GCGCTGGTCTCTGGTGTTTAGTGGAAGGAGACACGTCATG
CAAGACCAAACTAGATCCTCCGCTGGACGGCACAGAATGC
GGAGCTGATAAGTGGTGCCGGGCCGGTGAGTGTGTCAGTA
AGACGCCAATCCCGCAGCATGTGGATGGAGACTGGAGTCC
CTGGAGCACGTGGAGCATGTGCAGCCGGACGTGTGGCACA
GGAGCACGCTTTCGACAGAGGAAATGCGACAACCCGCCGC
CCGGTCCAGGAGGAAAATACTGTCAGAAGGCCAGTGTTGA
GCATAAAGTGTGTGAGGGTCCGCCGTGTACAAAGGGTCTG
CCTACATTTAGAGACCAGCAGTGTCAATCTCATGAGCGAC
AAGCCAGTAAGAAGAGCCAGATGTGGACAGCGGTCATCGA
TGATGAAAAGCCGTGTGCTTTGTATTGCACACCCGTCGGC
AGTGATTCCCCAGTGTTAGTGGCAGAACGGGTGCTGGACG
GGACGCCATGTGGACCTTATGAGAGCGACCTGTGTGTGAA
CGGAAAATGCCAGAAAATCGGCTGTGACGGCATCATCGGA
TCATCTGCGAAAGAAGACAGATGCGGCGTCTGCAACGGTG
ACGGCAAATCCTGCAGGATCGTCAAAGGAGACTTCAACCA
CTCCAAAGGAATGGGCTACATCGAGGCGGCTGTGATTCCA
GTGGGAGCTCGGAGAATCAAAGTGGTGGAGGACAAACCGT
CACACAGTTTTCTGGCTCTGAAGGACTCCAGCAAGAGATC
CATAAACAACGACTGGAAGATTGAGCTGCCCGGGGAGTTT
GAGCTCGCTGGCACCACGGTGCGCTACGTGAGGAGAGGAT
TGTGGGAAAAGATGTCCGCCAAGGGACCCACTAAAACTCC
ACTCCATCTCATGGTTCTGCTGTTCCATGATCAGACGTAT
GGGATCCACTATGAGTATACAGTGGCTCTGAACCACTCTC
AGGAGAACAGCAGTGATCTGGTGAAGGAGCCCGAGCACAT
GTACCTGTGGACCCACAGCAGCTGGGAGGACTGCAGCGTG
CACTGCGGAGGAGGAGAGAGACGGACTGTGGTGTCTTGCA
TGAGAATCATCAATAAGACCATGACTCCAGTAAACGACAG
CTCCTGTCAGGTGGAGAACAAACCCTCGCCTCAGATCCGC
CAGTGTAACATCCACCCCTGCCAATACAGGTGGGTGACTG
GTGATTGGACGCAGTGTTCGTTAACCTGTGGTAAAGGCTT
GCAGCAGAGGGAAGTCGGCTGCATTTACCAACTGCAAAAT
GGCACATATATTCCCACCAGAGACCTGTACTGTCTGAGCT
CCAAACCGGCCAGCGTTCAGCACTGCGAGGGACGTCACTG
CCTCACCGTGTGGGAGGCATCCGAATGGTCGCAGTGTTCC
TCTGAATGTGGACACGGCAGCAGGAGGCGGACGGTGACCT
GCACTAATCCTCATGGTCTCTGTGACCCTGTGTCCCGTCC
CGCTGAGGTGGAGGCCTGCGAGGACCACTCCAAATGTTAC
GAGTGGAAGACCGGCGAATGGTCCAAGTGCTCGTCATCAT
GTGGGCGGGGCTTGCAGTCCAGAGTGGTCCAATGCATGCA
CAGAGTGAGTGGTCGCCACGGCAGCGACTGTCCAGCAGTG
CTGAAGCCGGCGACGTACAGACAGTGTCATCAGAGCACCT
GTAACGCCAGAGGGAACATCAACACAATCACCTCTCCAAG
ACTGGCTGCATTGACGTATAAGTGCGTGGGCGATCAGTGG
GCGGTTTACTGCAAGGTGATCCGGGAGAAGAACCTGTGCC
AGGACATGCGCTGGTACCAACGCTGCTGCCAGACCTGCAG
AGACTTTTACACCAACAAAATGCCCCCCAAGAGTTAATGA
GCCCGGCACAGCCACACATAGAGCTTTATTTTTGCCTTTC
TCATTTGTACTGTTGAGAATAATGTTTTATATTCTTTTAA
AAAGTTATAATGTGTAAATGAAAGCAGCGGACAGACATTT
CCAAGCAGAACGTTTCTAACTATGCAGATTTTGAAGGCAC
TGAGGTTTGTCTCCACCTAAGTATGTGTTGGCCGTGTGTT
TGCGTACTTGAGTAACGTTTAGTTCTTGTTTTTGGACTTG
AAGGTTTCTTGTTTTGCTGTAATCCACTCTTTGCCCCTGG
AAATGAGTTTTTTAGTATCATGTTGCACTGTGGGTAAAGC
TAATTTCACCAGATATCCAGCTGAGGTTGCTTTTTTAAGG
CCACTGGTTGGCCATTAACTGATGGACTTTAACAATCTTT
TGTCTTGCTTTTACTTTAATTATTTTACTATTTTAGTAAC
TTCTGTTGTCATGTTCGCTCTTGCACCCAAAACCTAGTGA
GCTTTCTTGGTCCTTTATTCCCTATTAGTTTTGGAATTTC
TTTATAAGCCATAAATATTTGAATAAATTGGCAAATAAAC
TTTTAACAAAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations