ZFIN ID: ZDB-TSCRIPT-160112-414
Transcript Name: tsen2-201
Previous Name: tsen2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain:
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000062559 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000062559|OTTDARG00000043198| tsen2|OTTDARP00000048910 tsen2-001 LG_1 CABZ01008491.1,CABZ01008490.1,CABZ01008489.1 Danio rerio protein_coding KNOWN, 769 bp
GATCAGCCGGCTGAGCTGGTGTGCAGAATCAACCCGTTCC
CCATGCTTGAGTACCTGCAGCTCAGTTATGAAGAGGCTTT
TTTTCTGGTCTATGCTCTTGGATGCTTGTCCATTTATTAT
AATGGGGAGCCTCTGTCTGTCGCTCAGCTGTGGACGATGT
TTCGCTCGCTGCAGCCAAACTTCTGCTTCTCCTACGCGGC
GTATCATTATTACCGCAGTAAAGGCTGGGTGCCGAAGTCT
GGAGTTAAATACGGCACCGACTTAATGCTCTACAGAAAAG
GACCGCCGTTTTATCATGCAAGTTATTCAGTGGTTGTGGA
TACAGTAGACGCGTCTTTCAGAAGATCATCTCTGCGTCCC
TTCAGCTGGAGATCTCTGGCCACTCTCAGCAGAACCACTG
GAAACGTCTCCAAGGAACTGATGCTCTGCTTCATCATCAC
TCCATCAGATGTGACTGGAGATCTGCTGGTTTCTCCTCAG
TGTCTCAAACGCTTCTCAGTGCAGGAGGTGCTGATGAGCA
GATGGGTTTCCTCCAAAGAGCGAACCGAGCAGGAGGAAAT
ATAAACATTCACGACAGATCATTCTCGTTTCTTCCAGTCA
TCTTTATTTACGCTTATTTATTTTGGTGAATAATATGCAG
AGAGTGTTCAACAATAAATGCACATCAGGACATCTCAGAA
TGTCATCTGCTGGTTAATCACTCAACATCATGATGGTATA
CAGCGCTCAGCAGAAGTCAGCACACCCCTTTAAAAACTTA
CATTTGTGT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS

Genome Resources: Vega_Trans:OTTDART00000062559 (1),  Ensembl_Trans:ENSDART00000104505 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC124530 (1) 1577 nt
GenBank:BC153526 (1) 1536 nt
GenBank:EE312521 (1) 863 nt
GenBank:EH477130 (1) 862 nt
GenBank:EX159583 (1) 700 nt
CITATIONS (2)