Community Action Needed: Please respond to the NIH RFI
Transcript

pparg-202

ID
ZDB-TSCRIPT-160112-412
Name
pparg-202
Previous Names
  • pparg-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000062553 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000062553|OTTDARG00000043193| pparg|OTTDARP00000048906 pparg-002 LG_1 CABZ01069323.1,CABZ01069322.1,CABZ01069321.1,CABZ01069320.1,CABZ01069319.1,CABZ01069318.1,CABZ01069317.1,CABZ01069316.1,CABZ01069315.1,CABZ01069314.1,CABZ01069313.1,CABZ01110832.1,CABZ01061869.1,CABZ01061870.1,CABZ01061871.1,CABZ01061872.1 Danio rerio protein_coding KNOWN, 535 bp
GCACTGCTGACTGGATCGACAACACACACCGATCAAACCT
GTAGCGTGCGCACAATTACACACACACACACACACAAACA
GGCTCGCATGCACATCAGGATAAAACACACACACACATAC
ACACACAAGAAAACTTTTGCAACTCTCAGACAAGACGACA
GACAGACAGGAGGAGGAGGAGGAGGAGAAGATCTCTTTAT
ACACCTTCAGCAGACCCGACAGATATGGTGGACACGCAGA
CGTTTGGCTGGCCCGTGGGCTTCGGCCTGAGCGCTCTGGA
ACTGGAGGAGCTGGAGGACGACACGCACTCGCTGGACATC
AAGCCCTTCTCCACGCTCGACTACAGCAGCATATCAGGCA
TCGACTACGAGAACAACCCAACACAGAACGACCCAACCCC
GCACATGATGGACCTGACGCACATGTACAGCTTACAGGAC
ACAGGAGAACTACAGGACACACGAGCCCATCTACAGGCCA
GAACACAGCAGCTACAGCCCTGAGGAGAACACATACAGAG
CACAGCAGATACAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations