header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-160112-307
Transcript Name: rlbp1a-202
Previous Name: rlbp1a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain:
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000063222 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000063222|OTTDARG00000043580| rlbp1a|OTTDARP00000049451 rlbp1a-001 LG_1 CABZ01059989.1,CABZ01059988.1 Danio rerio protein_coding KNOWN, 1459 bp
CTTCGGCTGAGTTTCCATTCAGCCCGTGGAGAATCTGAGC
ACTATGGCTGCTACTGGAAGTTTTCGTATGGTGTCCGAGG
AGGAGCAGGCATTACGGGCTAAGCTTGAACATCTGACTGT
GAAAGACCACGGGCCAGTGTATGGACCTTGTATGAGACTG
CCGGATCATACAAAACAGAAGGCTAAAGATGAGCTGAACG
AAACAGATGAGAAGAGAGCGTCTGCTATAAAGGAACTCAG
AGCCATGATTAAAGACAAGGCAGGCCAAGGAGATGAGGTG
GCCAAAACTGTGCAAGACAAATTCAGCAAGGAGCCTGACT
CTCTACTCCTGAGATTCATACGTGCGCGCAAGTTTGACGT
GGCCAGAGCACACGAGCTCATGAAAGGATATGTGCGTTTT
CGGCGAGACTATCCTGAGCTGTTTGAGAATTTAACCCCGG
AGGCCGTACGCAGCACTATTGAAGCCGGTTACCCACGAAT
CCTCTCCACCAGAGACAAGAACGGCCGAGTGGTGCTGCTC
TTCAACATCGACAACTGGGACCTGGAGGAGGTCACCTTTG
ATGAGACCCTGCGTGCCTACTGTGTAATCCTTGAGAAACT
TCTAGAAAACGAAGAGACCCAAATCAACGGCTTCGTCCTC
ATTGAGAACTTCAAGGGCTTCACAATGCAGCACGCATCTG
GAATCAAACACACCGAGCTGAAGAAGATGGTGGACATGTT
ACAGGACTCTTTTCCTGCCCGGTTTAAGGCTGTGCATGTG
ATCCACCAGCCCTGGTACTTCACGACCACCTACAACGTGG
TGAAGCCCTTCATGAAGAGCAAACTGCTGGAGAGGGTTTT
TGTTCATGGAGATGAGCTAGATGGCTACTTGCGGGACTTC
GGAGCTGAAATCCTTCCTCCAGATTTCGATGGAACGGGTC
CCGCTTGTGACGGCAGAGAAACAGCCATCAAACTGTTCGG
ATCTGAAGACACAGCCCTTTAAATGACCCACACAACACAA
GTATTTTGATGAACGTATGATCCAGACGTTTAATAGAAAC
TATATAAATTAAAGCCTTACAGATGTATAGTTTAACATTT
TTAACTGCCTTATTACCATGAAAGTATTATGAGCAGATCG
CAGAACAGTATCGTAGAGATGAAATATTGCACATTTCACT
TGCCGATACTTACAATTCTTACTGTTATTGTTTTTTAAAA
GAAACTTTGCTGAAGAGTTTTTCATTCTCTGCCTTGAAAA
TGGTGGTCGAGTTTATATAGTGTTTTGTACTAGTCATGTG
TTCAAAATAAGTGTAGTAGAGAATTAAATGCATAAACTTG
ATTACAAGCCTTAACCAAGGAAAAAGTTTTAGACTGAATG
TTGTGTGAAGTAGATGTTGTGGACGTCGTTTTAACCCATG
TTGGTTTTCCAGCCTGTCAAGTCTAATTGATATTTTCAAT
AAAATGGCCAAATGGTTCA

rlbp1a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA rlbp1a-202 1459
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
OTHER rlbp1a-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000063222 (1)
  • Ensembl_Trans:ENSDART00000169828 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC059449 (1) 1478bp
    GenBank:EU348853 (1) 1478bp
    GenBank:CO930376 (1) 798bp
    CITATIONS (2)