header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-160112-272
Transcript Name: dusp19b-202
Previous Name: dusp19b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000063106 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000063106|OTTDARG00000043503| dusp19b|OTTDARP00000049344 dusp19b-001 LG_ CU459024.14 Danio rerio protein_coding KNOWN, 3137 bp
TTCTAGCAACGTTCTCCGGTTTGTTTTGAGCGCATTTCTC
TTCAGCTTCTCAGCAGTTTCGGATGTCGTGAGTAAATAAA
TAAAGATGAATTCCCTGGCGCAGGAGATCGCGGGTTTCTC
TACGTCTCGGCTGAGGAAGCAGAGCACCAGAGTGACCACA
GCGAGCGGTCAGGTCCTCCTGGAGACCCGCAGCGGCGCTG
ATTACCACAGCACGCCGGACACGGAGCGCCAGAGCGCGGA
TACCTGCGGCTTCGTGCAGGACTTCAGTCTGGATCTGCAA
GTGGGAATCATCACACCCTTCCTGCTGCTCTGTGCGGCAT
CTCAGGACGCTGCTCATGACATCGACACGTTGAAGAAACT
AAAGGTGACTCATGTGCTGAATGTGGCGTTCGGGGTGGAG
AACGCGTTTCCTGAACTCTTCACATACAAGACTGTCAGCA
TGCTAGATCTTCCAGAGACGGACATCACTGCATACTTCCC
AGAATGCTTTGAGTTCATAACACAAGCCAGACAGCAGGAT
GGAGTGGTGCTGGTTCACTGCAACGCTGGCGTTTCTCGCT
CTGCTTCAGTGGTCATCGGGTTCCTGATGTCTGAGCTGAA
GATGTCCTTTGATGAAGCCTTCAGTGTTGCCAAAACCTCC
AGACCGCAGATTCAACCAAACCCCGGCTTTCTCCAGCAGC
TCAAGACATATAATCCAGCATGAAACACACACACACACAT
CCACAATGTGCTTCAGTGCCTAGATGTTTTTCACACCTGC
TGCTTGATTATGCTAATGAGCTGAGGAGGTCACACAGGTG
TGCTGAATATGTCTCACACTCAACATAAGGGCTGTTTCTC
AATTCCAAGAACGCAGAGAACGGACTTGTGTTCTTGTGGA
GACCGGTCTTGCCAGGTGTCCTCGGAAGAACGAACTCGGG
AGACCACGAGGGCAGAGAACGCGTCATTTGAGAAATGAGA
TGCCGCGTTCCTCCTGATGGTCACATGACCTCCACGCATT
TTAAATGGTAAACTATTTAAACATTACAGCCTTCATACAA
CGGTTTCCCCGCTCTTCACAATATATACTTTGCATAAAAA
TATTATAAATATACTCTGCACAATATAAATATAACCGTTT
TTAATATGAATTTCAGCAAACAAACACCCTTAATGTGTTT
ATTCCTTTATTAAGATGTCCATGGTAATGTTTACTTTGAC
CGTTTCCTTTAGGCAAACTTCTGAGGTAAATAAGTGACAT
CTCTGCACTTTAATAATAAATTGGGTTAAATTGCTGCGCT
TCCCACCTCCAGTCGCAATGACTTCTGGGACTTCTAAAGC
GAGTTCGGTGATCAAGTCTGCATCGCTGCGTCCTCGATAT
CAAAGAGCTTAGAATGACCAAGAGGCGACACTCTAGTGTA
ATTTGGGAAACAGCCACTAGAGGGCGCGGCGGCCATTTTG
GAATGAAAACTCTAATAGAACAACAGCATATTATTGACCT
TATTCTAAAATGTGGAAGTGCGCCTGTTTTCGCGATTGTC
TTAGAACTTCCGATTCAGTCGCCTATGGGAGAAATGACAA
GGAATAATAAACGGCAGAAAATGGCCAAACTACTTGCTCA
ACAAACAAATGTTTGCATGACTACACAGACCAAGTAGCAT
ATTATAATAAGAAAATGTTAAATTGCAACATCAAGCAGCG
TAACGAGCAGTTGTTAACGTCAAAAAATGAATGGAAGTGA
ATGTGACCGGAAGTCGCGAGACAAAAAGATTCAAATGGCA
GCGCCCACTCGACAGCTGAGAATAAGGTGAATAAGTCTGT
AAAATAAACTATTAAAAGTGCTGATGATTGTGATAGTAAA
GGTTGTATTGTCGTCTTTCATGTTGTATCTCAGCTTTAAT
ACGCTTTTTAAATAGATAAATGAAAAACAAAGCAGCTGCT
TGCCATCGCGAAAGTAATGAGATCCAATGGACGGCCGATC
ACTTTCACTACTAAATGGTGGAATCCAGGGCTGTTGCTGG
GCGCTGCTGTTGCATTGGAACGTTCTATTGAGTGTCGCCT
CGGTCATTCTAAGCTCTTTGTCGATATCAAGAATACATCC
GGGAAGTTTCATGCGCCCTCTGTACTTGCGGAACTGAACT
TAGGCAGCTGATGATGATGTTGCACGAGAACACGAGGACG
CAAGACCGCTGAAGAACGCATATTGAGAAACAGCCAAGAT
GCTCCAGAACCAGTGTTGAGATGTTTTTACTGCCAATAAA
GGGAAATATAGAGTAAAAGATAAGGAAACTAATATATAAT
TTAGAAAGGTTTCCAACACAAATACATTATAAGCATCAAA
TTTTATTCATTTAAACCAGAATGTTGTCATTTTAACAAAC
CACCATTCATTCATTCATTTTCTTTTACGTCTTAAACTAT
GGTCACACTAGAGTTTGTGTGTGCTTAATTCTGTCGTACG
GCGCTTCATAACAGGGCGGGATTAAACAAGCTTATTAGAC
ACTTAAAAAAAGCGAGCGATTGCTCCATGTTTACATTTCT
GTCCAGAGAGGTCATGTTTTGATCCTCGATTGATCTCACG
TTGTCAACTTAACGCATTCGCGTGCGTATGAATGGCAGTC
AATGGGAGGAAAAGCCCAGTGTGACCGCAGCTTCAGTCCC
TTTATTAATCTGGGGTCGCCACATTGGAATGAACCGCCAA
CTTATCCAGCATATGTTTTACACAGCGCATGCACTTTCAG
CTGCAACCCATCACTGGGAAACATCCATGCACACCCATTT
ACACACACACTACAGACAATTTAGCTTACCCAATTCCCCT
ATCCTTCGCATGTTTTTTGGACTTGTGGGGGAAACCCACG
TCAACACGAGGAGAACATGCAAACTCCACACAGAAATGCC
AACTGACCCATCTGAGGCTCAAACCAGTGACCTTTGTGCC
GTGAGGGGATCATGCTACTTACTATCAAAAGACCATTATA
GTTTCCAATAAAACAGCATAATTTACATTGTAAAAATGTA
AATAAATTCCATGAAGGTTTCTATTGTTTTAGGAAATGGC
AGGCCTCATATTTATATCAATTTTTTTGGATATTTGTTTT
TAAATAACTGTTTATATTTATGCTTGTTTCATAAATTAAA
CTTTTTATTGATGTTCT

dusp19b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA dusp19b-201 (1)    Ensembl 791
dusp19b-202 3137
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dusp19b-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000063106 (1),  Ensembl_Trans:ENSDART00000173270 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC069175 (1) 1511 bp
GenBank:CD282879 (1) 569 bp
CITATIONS (2)