header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-160112-590
Transcript Name: dusp19b-201
Previous Name: dusp19b-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000063107 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000063107|OTTDARG00000043503| dusp19b|OTTDARP00000049345 dusp19b-002 LG_ CU459024.14 Danio rerio protein_coding KNOWN, 791 bp
TTCTAGCAACGTTCTCCGGTTTGTTTTGAGCGCATTTCTC
TTCAGCTTCTCAGCAGTTTCGGATGTCGTGAGTAAATAAA
TAAAGATGAATTCCCTGGCGCAGGAGATCGCGGGTTTCTC
TACGTCTCGGCTGAGGAAGCAGAGCACCAGAGTGACCACA
GCGAGCGGTCAGGTCCTCCTGGAGACCCGCAGCGGCGCTG
ATTACCACAGCACGCCGGACACGGAGCGCCAGAGCGCGGA
TACCTGCGGCTTCGTGCAGGACTTCAGTCTGGATCTGCAA
GTGGGAATCATCACACCCTTCCTGCTGCTCTCATCTCAGG
ACGCTGCTCATGACATCGACACGTTGAAGAAACTAAAGGT
GACTCATGTGCTGAATGTGGCGTTCGGGGTGGAGAACGCG
TTTCCTGAACTCTTCACATACAAGACTGTCAGCATGCTAG
ATCTTCCAGAGACGGACATCACTGCATACTTCCCAGAATG
CTTTGAGTTCATAACACAAGCCAGACAGCAGGATGGAGTG
GTGCTGGTTCACTGCAACGCTGGCGTTTCTCGCTCTGCTT
CAGTGGTCATCGGGTTCCTGATGTCTGAGCTGAAGATGTC
CTTTGATGAAGCCTTCAGTGTTGCCAAAACCTCCAGACCG
CAGATTCAACCAAACCCCGGCTTTCTCCAGCAGCTCAAGA
CATATAATCCAGCATGAAACACACACACACACATCCACAA
TGTGCTTCAGTGCCTAGATGTTTTTCACACCTGCTGCTTG
ATTATGCTAATGAGCTGAGGAGGTCACACAG

dusp19b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA dusp19b-201 791
dusp19b-202 (1)    Ensembl 3137
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dusp19b-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000063107 (1),  Ensembl_Trans:ENSDART00000066450 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EE310834 (1) 910 bp
GenBank:EH115307 (1) 889 bp
GenBank:CK396912 (1) 850 bp
GenBank:DN896414 (1) 676 bp
GenBank:BQ618803 (1) 515 bp
GenBank:EB833859 (1) 391 bp
CITATIONS (2)