ZFIN ID: ZDB-TSCRIPT-160112-175
Transcript Name: si:dkey-286h17.4-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: antisense
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000062800 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000062800|OTTDARG00000041719| DKEY-286H17.4|no_translation DKEY-286H17.4-003 LG_none CT009687.10,CT573220.8,BX511223.6,BX510944.11 Danio rerio processed_transcript NOVEL, 595 bp
AACATGGATGAAGCTTTATCTAATGAGTTTAGCATAAAGA
GCGAACAGTCATTACTACTATTCAGTTGAGGATACCTCTT
CTTCACTGGGCCGGGCAGTAGTGGCGCCATGGCAACATGC
TGATGAACTGGGGGGGGGTGGGGGGTGGGGGGGGGGTGAC
TGGCACCTGTTGGGCCCACTGCCTTCCTCCATTTCCATTG
CTCTTTCATGCAACACACTCCTCTCAAAGTGCTTTACAAG
GTGCGAAGAGCCTGAACCACAACAATTGAAATGTGAGCTG
AACGTTCAGCTGCAGTCATCAATCATCTTTCAATCAATCA
CTGTCACCCCCGCTGCTTCGCCACCCAGCCTACGGCACCT
TGAGCACTAGAAAACGTGACTTTCAGTTACACTGTATTTT
GATGGTCCCCCAGTTGACACTCTGCTGAATGTAAGTAACT
TTGCAACACGTCAAACACCAGTCATTAGTAGACTACCTTC
TTAAGTTAGCGTCAGCAAAGTGACATCATTTCCTGTTCTT
GATTAGATGCTTTGTTGTTGTATTTCATTCATTCGTATTT
CAGTTTCATAATCCTGTTTGACTTACTGTATGTAA

si:dkey-286h17.4 TRANSCRIPTS
Type Name Length (bp) Analysis
antisense si:dkey-286h17.4-001 (1) 1426
ncRNA si:dkey-286h17.4-002 (1) 680
antisense si:dkey-286h17.4-003 595
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-286h17.4-003 Contained in:
OTHER si:dkey-286h17.4-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000062800 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BM889971 (1) 626bp
    GenBank:BM775508 (1) 563bp
    CITATIONS (1)