ZFIN ID: ZDB-TSCRIPT-141209-582
Transcript Name: si:dkey-286h17.4-001
Previous Name: dkey-286h17.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: antisense
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000060133 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000060133|OTTDARG00000041719|ZDB-GENE-141216-312 si:dkey-286h17.4|no_translation DKEY-286H17.4-001 LG_none CT009687.10,CT573220.8,BX511223.6,BX510944.11 Danio rerio processed_transcript NOVEL, 1426 bp
GTGGCGATGTCAAACAGCAATTATAGAATGCCGCAGTCTC
GAGAATGCAGGTGTTTACTGTCCTCGTTGAGCATCGACGA
GCCCGTGGAACAGTTTAGCATAAAGAGCGAACAGTCATTA
CTACTATTCAGTTGAGGATACCTCTTCTTCACTGGGTCAG
ATGGCGGAGGGGTTGCAGACGGAGGGCTGGAGCCAGTTCA
ATATCTTCTCACCTGTGCCTTTAGAGGACATAATGCCTTG
AGCCGGGATGATTCTGAACAGAACACTGAACTTCATGTGT
GTCCGTCTCTCACTGTAAGACCACTGGACTTCTGCTAAGA
CATTACACAGAATTCCTGATAAAGCTGACTGCTGGTCAAC
AACAGCTTCCCTCAGATCAAGGTGAAAAAAGGAAAGACAA
AATCTAAAGCAGCGAAAAGGGAAGAAAAGAGAGTTTCCGG
CTCTCGGGCCTCGTCTGTATTATCCAGGGATTCATCCGAA
CACACACGCACACACACCCCTGATGGAGTCATCTGGCGAA
GGCATGGCGCTGTTTTTTGGTTCAGAATGATGGGAGATTT
ATAGAGGTTTCATTGAACCCACGCCTCGGTGTCATAAAAG
TTTATAATATTTTTTCCAGGATGAAGATTTTTAAGCATAT
CTTTACCTCTAGCATGAAGATATAATTCACAGAGCCTGTA
ACTCACCGTGCTGTGGCAGAATTTCAAAGCATTAATACTG
GACTGCTTGAACATGATAAATGAGGTCTTTGACGCTCCTC
CGCCGAACAGTTCTACATGCAGACGGGGAGAACAGGCAGG
ATCGAGATTACTGTAAAAGTCAAGCAGTCTGATTGCTCAC
ACTTTAGAGTTTGACATTTACTTTCCCCATTGTTTGTGCG
CTACACTCCATCTGTGTAGTTTGGCTGACATTATTATCCT
GTCAAAAGTTGGAACTGAATCAGGCTAAAATAATGACACA
CCATATTTCACTTTTCACACACACACACAGACGCACACAC
GCACACAGGCCCACACATATGCCCATAAGCACACTCACAC
ACATACACACACACGACACACAAATCTTTTTTTTCCATCT
GTGATTTCCTAGGTACTATAAGCTCTGGAAAATTGAATGA
ATCCTTCACACAGTTCTCCAACACACTGTTTTCTTGTGTA
TATATATATCCACCTCTATAGTGCGATATATATTTTTTCG
AGTGCCGCATTCGCTCATATTGTTTTTCTTTCATTTCTCT
TGCTTTCAATCCCACAGGCTACATTTTCATCATTACTCCA
CGGGATTGGTCTTTCTGAAGTCGGTTTGTGGGATTTTTTT
CTGCACATTTGCTCCACCTTGTGGTGGAAAATACGCAAAA
AGAAATGATTAGGATGATATTTTTTTATTTTATTATATGT
AGATACAATATATACAGTATACTGTA

si:dkey-286h17.4 TRANSCRIPTS
Type Name Length (bp) Analysis
antisense si:dkey-286h17.4-001 1426
ncRNA si:dkey-286h17.4-002 (1) 680
antisense si:dkey-286h17.4-003 (1) 595
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-286h17.4-001 Contained in:
OTHER si:dkey-286h17.4-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000060133 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCESNo data available
    CITATIONS (1)