Transcript

cdk4-201

ID
ZDB-TSCRIPT-160112-101
Name
cdk4-201
Previous Names
  • cdk4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000062573 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000062573|OTTDARG00000043207| cdk4|OTTDARP00000048921 cdk4-001 LG_ CU633839.6 Danio rerio protein_coding NOVEL, 2925 bp
TTCTTGATGTGGTTGATGCGCACCAGCACACCCTGCCCAC
GGTCACGGAGGATCAGCAGCTTCTCCGCCAGTTTCAGCTG
GTAGGCCATGATGGCGCAGGAGGTGGGGCTGCAGTATGAG
CCAGTAGCAGAGATCGGGGGCGGGGCTTACGGGACCGTCT
ATAAGGCTCGGGATCGGGACAGCGGGCAGTTTGTGGCGCT
GAAGAGCGTTCGGGTGCAGACCAATCAGGACGGACTCCCA
CTGTCCACGGTTCGAGAGGTGGCTCTGCTGAAGCGCCTGG
AGCAGTTCGACCATCCCAACATCGTCAGGCTGATGGACGT
GTGCGCGACCCTCAGGACGGATCAGGAGACTAAAGTGACG
CTGGTGTTTGAACATGTGGATCAGGATCTCAGGACATACC
TGGAGAAAGTTCCAGCACCGGGACTGCCTGTGGACAAAAT
CAGAGACCTGATGCAGCAGCTGCTGTGTGGTCTGGCGTTC
CTGCACACTAATCGAGTTCTCCATCGGGATCTGAAGCCGG
AGAACATCCTGGTGACCAGCAGAGGGCAGGTGAAGCTGGC
GGACTTCGGGCTGGCGCGCATCTACAGCTGCCACATGGCA
CTGACCCCGGTGGTGGTGACGCTGTGGTATCGCTCTCCTG
AGGTGCTCCTGCAGAGCACATACGCCACACCAGTGGACAT
CTGGAGCACCGGCTGCATCTTTGCCGAGATGTTCAGACGC
AAGCCTCTGTTCTGCGGAGATTCAGAGGCGGACCAGCTGG
GGAAGATCTTTGCGGTGATCGGTCTGCCGGCGGAGGATCA
GTGGCCCACAGACGTCACTCTTTCCCACCACAACTTCAGC
CCTCAGAGCCCTCGGCCAATCACAGACTGCGTTCCGGACA
TCACAGAGAAAGGGGCGGAGCTATTGCTGAAAATGCTGAC
CTTCGACCCGCTGAAGAGGATCTCTGCGCTGAACGCTCTG
GATCATCCCTTCTTCAGCGAGTGATGCTGCTCTACACACA
CACACACACACACACACACACACACACACAAGCCAGCAGA
CTGAAGATAAACATTCCCTGAGTGTGTGTGTGTGTGTGTT
CATCTGCTCTGTGATGAAGAGGAGCTTAAATCAGGGGTGT
CAAAGTCAGTTCCTGGAGGGCCGCAGCTCTGCTCAGTTTA
GTTTTCCCCTAATTAAACACAGCTGATCACACTAATTGAG
TCCTTCTGGCTTGTTTGAAAGCTCCAGGTGAGTGTGTTGG
AGCAGGGCTGGAGCTGAACTGTGCAGGGCTGCGGCCCTCC
AGGAACTGAGTTTGACTCCGCTGGCTTAAAGGGTCAGTTC
ACCCACAAATCAACATCTACTGGCGCTTATCTCTCCCTCA
GGGGGTCTGAAACCTGTTGGAGCTTCTCTCTTCTGTTCAA
CATGAAAGAAGATATTTGGAAAAATGTTGTAATTATTGAC
ATCTAAAGTAGGAGAAACAAATAGTATATAAGTCAATGGT
TGCTGGTGTTCAACATTTTTCTAAATATCTTCTTAATGTT
TAACAGAAGATGGGTTAAAGACCCCGTGAGGGAGAGATAA
CCCTAAGTAGATGTCGATTTGTGGGTGAACTGACCCTTCA
GTGCTCGTTCTCCATCAGTGTGATGTTATTAGTGTTCACA
GAGGAGGATCTCTGCATGACGATCATGCTAAACAAACTGC
CCATGTGACGAGTGAGGGAGTGAGTGAGGGAGGGAGTGAG
TGAGGGAGTGAGTGAGGGAGTGAGGGAGTGAGTGAGTGAG
TGAGGGAGTGAGTGAGTGAGGGAGGGAGTGAGAGAGTGAG
TGAGGGAGGGAGTGAGGGAGTGAGTGAGGGAGTGAGTGAG
TGAGTGAGGGAGTGAGTGAGTGAGGGAGGGAGTGAGAGAG
TGAGTGAGGGAGGGAGTGAGGGAGTGAGTGAGGGAGTGAG
TGAGTGAGGGAGTGAGAGAGTGAGTGAGGGAGTGAGTGAG
GGAGTGAGAGAGTGAGTGAGGGAGGGAGTGAGAGAGTGAG
TGAGGGAGGGAGTGAGGGAGTGAGTGAGGGAGTGAGTGAG
GGAGTGAGAGAGTGAGTGAGGGAGGGAGTGAGAGAGGGAG
TGAGGGAGTGAGTGAGGGAGGGAGTGAGTGAGGGAGTGAG
TGAGTGAGTGAGGGAGTGAGTGAGTGAGTGAGGGAGTGAG
TGAGTGAGGGAGGGAGTGAGAGAGTGAGGGAGGGAGTGAG
GGAGTGAGTGAGGGAGTGAGTGAGTGAGGGAGTGAGAGAG
TGAGTGAGGGAGTGAGTGAGGGAGTGAGGGAGGGAGTGAG
TGAGTGAGTGAGGGAGTGAGTGAGTGGTGAGTGAGTGAGT
GAGTGAGTGAGTGAGTGAGTGAGGGAGGGAGTGAGGGAGG
GAGTGAGAGAGTGAGTGAGGGAGTGAGTGAGGGAGTGAGG
GAGTGAGTGAGTGAGTGAGGGAGGGAGTGAGGGAGTGAGT
GAGTGAGGGAGTGAGTGAGGGAGTGAGTGAGGGAGTGAGT
GAGGGAGTGAGTGAGGGAGGGAGTGAGGGAGTGAGTGAGT
GAGGGAGTGAGTGAGTGAGTGAGTGAGTGAGGGAGTGAGT
GAGTGAGTGAGTGAGTGAGTGAGTGAGGGAGTGAGTGAGT
GAGGGAGTGAGTGAGGGAGTGAGTGAGGGAGGGAGTGAGG
GAGTGAGTGAGTGAGGGAGTGAGTGAGTGAGTGAGTGAGT
GAGGGAGTGAGTGAGTGAGTGAGTGAGTGAGTGAGTGAGT
GAGGGAGTGAGTGAGTGAGGGAGTGAGTGAGGGAGTGAGT
GAGGGAGTGAGGGAGTGAGTGAGTGAGTGAGTGAGTGAGT
GAGTGAGGGAGTGAGTGAGTGAGGGAGTGAGTGAGGGAGT
GAGGGAGTGAGTGAGGGAGTGAGGGAGGGATGAGGAATGA
TTCGTGTTCGTCTCCATCATCCTGAAATAAAGCCGTTCAT
TTATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations