Transcript

gabra2a-202

ID
ZDB-TSCRIPT-141209-959
Name
gabra2a-202
Previous Names
  • dkey-52k1.6-001
  • si:dkey-52k1.6-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000061439 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000061439|OTTDARG00000042546|ZDB-GENE-141216-16 si:dkey-52k1.6|OTTDARP00000047837 DKEY-52K1.6-001 LG_ CR792443.13 Danio rerio protein_coding PUTATIVE, 1530 bp
GAAAAACAGGACAATGATTCTGCGACGGGGTCATTCTCAC
GGATTTCTAATCCACCTGTTTCTGCTGGTTTTATGGCGTG
CATGTTCTGAGGCAGAAGTATCCGGCTCAGATGCCTTTAA
AAATAACATTACCCTCTTCACGCGGATCTTGGACCGGCTT
TTGGATGGCTACGACAACAGGCTGAGACCTGGTCTTGGAG
ATCGAGTGACAGAGGTGAAGACTGATATATATGTGACCAG
TTTTGGACCAGTGTCCGATACAGACATGGAATACACAGTG
GATGTGTTTTTCCGACAGCGATGGACAGACGAGCGGCTCA
AGTTTCACGGGCCAATGAACATCCTGCGTCTCAACAACCT
GATGGCCAGTAAAATCTGGACTCCAGACACTTTCTTTCAT
AACGGCAAGAAATCTGTGGCTCACAACATGACCATGCCAA
ACAAACTCCTGCGCATCATGGAGAACGGCACCTTACTCTA
CACCATGAGGTTGACTGTTCAAGCTGAATGCCCAATGCAT
CTTGAGGACTTTCCAATGGATTTCCATTCATGTCCACTTA
AATTTGGTAGCTGTGAATATACAGTAATGACTGCCCATTT
CCATCTGAAGCGGAAGATCGGATACTTTGTGATCCAGACG
TACCTGCCCTGCATTATGACCGTCATCTTATCTCAAGTCT
CTTTTTGGCTCAACAGAGAGTCAGTTCCGGCACGCACAGT
TTTTGGTGTGACTACAGTGCTAACCATGACCACTCTGAGT
ATCAGCGCTCGAAACTCTTTACCGAAGGTGGCCTATGCTA
CAGCCATGGACTGGTTCATCGCAGTGTGCTACGCCTTTGT
TTTCTCTGCTCTCATTGAGTTTGCCACAGTGAACTACTTC
ACCAAGCGCGGCTGGGCCTGGGACGGAAAGAGCATTGTGA
ATGATAAGAAAAAAGAGACGTCCGTTATGAAAAAGAACAA
TGCGTATGCAGTCGCTGTGGCAAACTACGCACCCCACATT
GCAAAGGACTCTGCTTTGCCCACTGTCTCTAAAAGCGCTA
CACCAGAGCCCAGTAAAGCACAACCGGTGGCCAAAGAAAC
AAAGAAGACCTTCAACAGCGTCAGCAAGATCGACCGTATG
TCCCGCATTATCTTTCCAGTGCTCTTTGGCAGCTTTAACT
TAGTTTATTGGGCAACATATCTTAACAGAGAACCTGTAAT
TAAGAACATGGTACCCTCCCCGTGAGCCACTAGCTATTGC
GAAATACAATCAATCACAGTATAATACATGCAAAACAGGA
TACATAATATAAAAAATCTAAAAACCAAAATTTTGTACAA
ATTCCTCAGTGTTCTTCTGATATTTCTGTATCACAGCATT
CTAAAGTGATTGCTCTTTGCAGCCTCCTTAAAATCTCGCC
ACTGCCAGGACAATTTAGCATACTTTAACCGGACAAATCA
ACTTTTTTTCACAGCTTTATTTTTGTATGTTGTGGTGTGT
TTAACGGATTTCCTTGCCTTTTTATGCAATGTTTACTGGC
ATTTTCATAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations