Transcript

rnf207a-202

ID
ZDB-TSCRIPT-141209-929
Name
rnf207a-202
Previous Names
  • rnf207a-002
  • ch211-218g23.3-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000061331 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000061331|OTTDARG00000042475|ZDB-GENE-120813-7 rnf207a|OTTDARP00000047482 CH211-218G23.3-002 LG_ CR352256.11 Danio rerio protein_coding NOVEL, 806 bp
AGAGCAAACAGTGTCCAGACTCACTCGAGGGACTTATACT
GCCACAGAAACTGTAGGGTGGAGAGATTAACGGAGCTTTA
GAACTAAGGCTGTCTGCTCTCTTTATGCTGTGTCTGTCTC
TGTCTCTCAGTGAAATGCCTTTTGGCCGAAGGCCCACCTT
TCACAGACACATTTGCACCAAGGTGTTGCTGGCGGAAGGC
AGAGAGTCACCCTTCACCGAGCACTGCCGCAACTTCGAGA
AGAGCTACAGATCTCTTCAGACAGAAATCCAAAGGCTGAA
AGATGAGGTTCAGGAGATGCACAGAGACCTGACGAAACAT
CACTCTCTCATCAACACGGACACCATGAATGAAATCCTGG
AAAGATGTCTTCTCATTGACGAACAGATCGCGTCTCAGTA
CTCTGCCGTACAGACTCAGCGGACCGTATTTGAGGAGAAA
TGGGACGTGACCTTTCAAAGAGTAACCAATGAGCAAGAGA
TTTATGAAGCACAGCTTCATGACCTTCTGCAGCTGAAGCA
AGAAAATTCCTACTTGACGACGATCGCACGGCAAATTGGA
CCCTACATCTTATCCATAGCAAAAGTGAAAGAGCGTCTGG
AACCCAGGTTTCAAAAGCCTGAGAATGACTGCATCGACAC
TACAGTGAAAATCCATGAAGACCAGATCAGCTGCAAGAAA
AAGAGCTGCTCAGACAGAGACTCAGACAGCTCGCTTATCC
TGCCGCCCGACTAGAGGCTGCTAAAGAGAACTGACTTCTG
TTGGCAAAGAAAGCAGATTAACATTTCAGAGACCTCTCGT
GGCAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations