Transcript

rnf207a-201

ID
ZDB-TSCRIPT-141209-3372
Name
rnf207a-201
Previous Names
  • rnf207a-001
  • ch211-218g23.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000061330 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000061330|OTTDARG00000042475|ZDB-GENE-120813-7 rnf207a|OTTDARP00000047481 CH211-218G23.3-001 LG_ CR352256.11 Danio rerio protein_coding NOVEL, 793 bp
AGGTTTGGAGAGCAAACAGTGTCCAGACTCACTCGAGGGA
CTTATACTGCCACAGAAACTGTAGGGTGGAGAGATTAACG
GAGCTTTAGAACTAAGTGAAATGCCTTTTGGCCGAAGGCC
CACCTTTCACAGACACATTTGCACCAAGGTGTTGCTGGCG
GAAGGCAGAGAGTCACCCTTCACCGAGCACTGCCGCAACT
TCGAGAAGAGCTACAGATCTCTTCAGACAGAAATCCAAAG
GCTGAAAGATGAGGTTCAGGAGATGCACAGAGACCTGACG
AAACATCACTCTCTCATCAACACGGACACCATGAATGAAA
TCCTGGAAAGATGTCTTCTCATTGACGAACAGATCGCGTC
TCAGTACTCTGCCGTACAGACTCAGCGGACCGTATTTGAG
GAGAAATGGGACGTGACCTTTCAAAGAGTAACCAATGAGC
AAGAGATTTATGAAGCACAGCTTCATGACCTTCTGCAGCT
GAAGCAAGAAAATTCCTACTTGACGACGATCGCACGGCAA
ATTGGACCCTACATCTTATCCATAGCAAAAGTGAAAGAGC
GTCTGGAACCCAGGTTTCAAAAGCCTGAGAATGACTGCAT
CGACACTACAGTGAAAATCCATGAAGACCAGATCAGCTGC
AAGAAAAAGAGCTGCTCAGACAGAGACTCAGACAGCTCGC
TTATCCTGCCGCCCGACTAGAGGCTGCTAAAGAGAACTGA
CTTCTGTTGGCAAAGAAAGCAGATTAACATTTCAGAGACC
TCTCGTGGCAAAGAGCTGCCACTATAGAGCTGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations