Transcript

pprc1-201

ID
ZDB-TSCRIPT-141209-749
Name
pprc1-201
Previous Names
  • pprc1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000060726 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060726|OTTDARG00000042096|ZDB-GENE-030131-9858 pprc1|OTTDARP00000046927 pprc1-001 LG_ CR792443.13 Danio rerio protein_coding KNOWN, 4265 bp
CGCACTTACAGGGGAGGGGCTAAAGCGTTGAATTGCCGGG
AACGCAAATAGCACGTGGCTTGTAGCCGGCAGCTGCTGCG
CCTGCAGTTGATTCACGTTTCTCCACACAGTTGAGTTGCA
AGATGGCGGCGCGGTGGGGAACAGGCGAGGAGGTGTTAAA
AGTCTGTAATACTCAACTCTTCTCGAATCTTGACGAGGCA
GAGATGCTTCAGGGAAGTTTCACCAGCAACAGTTTGGAGT
TTACCGGCTTTAACAATGGAGATGCATTGGAGGCCTTGCA
TGGCTGCCTGGATCCATCTATTCTGTCCATTTTTGAGGAC
AGCCCCACTGGAGAAGTAAAAAGTAATCTTGATGAAGAAA
GCGAAGCGACGCTGCTCACAGCTCTCACTGAAATACTTGA
CAATGTTGATGATGAAAACCTCTCCCCTTTTGACACTTTG
CCAGATTCTGACCTGTTTTCTGGCCACAAGGGTCAGGAAC
ACTCACCGCTAAGGAAATTATTTACACGGTCTACTCCAGA
GTCAGTTATCCACACAAGACAGTTTCCTGGAAAGAGTCTC
CCACGAATGCAGAGACTTTCTCAGCAGAACAGTGAAGGAG
AAGAGGAGGAAGATGGAGATGCTAGTTTTTCAATCCCATT
ATCCAATATTGATTTGTTGTCTTTGGATGGATTTGATTGG
TGTCTTCCTGTGTCCTTGGAGCAGGACGGAGAGAGCATGC
CCGTCTCTCTTGGTGAATTAGTTAAACACATGCACCCTTA
CTGCATGACACTGTGTGTGGAAGGAGAAGAGGGCCAAGAG
CATCTCCTGCCAGAGAGGGGGCTTGTTTTGGAAGTGGTTG
ATCAAGGAGAGCATGGAGAGCCCATCCTGGCAATCCCTGA
TCTCAGCATCCCTCTTTCTCAGGCAGACCCCACAGAATGT
GAGCAAAGAGTTCCAGGAAATAGCATAGATAAACAGGAAC
CTAAGCATGATAATCATGCTCAAAAAGTCACGTCCCCTTC
TAATGTATCTCCTGTGGAGAAGGAGAAAGAAGTTGGCAAG
GTATGTAAAGGAAAAAAGAGGTGCAAATCTGTTGAAACCC
CTTTGGTTGAACAAAGAATTTTGAGAAGCTCAAAAGTAAA
TGAGGAGCCACAGAAGAAACCGCAAAAAGAACAAAAGAAA
AAGGTGACTTTTTCTCCATCGCTCACGTCAGCAGAACCTG
AGAGACCTAAACTTTACCCTCCAACAAAGGAGCCTGAGCC
ACGGGATGAGGAAGAGCAAACCATGACATCTAAAGCTGAA
ACAAAAATCACTAACCTAACAACAGACAACAATTCTCTTG
AAAAGCCTGGAGAGGAAGAACTGCCCTCAAAACAAGAAAC
TCCCAGTGAACAGCCTAGTGATTGTCAGCGCAATGAAACA
AAGCCCAAACCTCTCAGCTTACAACAGTACCGTCTCCTCC
GCCAGCAGAAAAAACCAGACCCAGTGGACAAAACAGAGGA
TTACAGCACTAAATGGCCCACGTTGCCTGAGGCTCCCAAA
GAACTTCCTCCAATACCCTGCCTGCCAGACCCCAGCCTCA
GAGATCCACGTAAAACATCCCATATTCCTGTTAAAAAAGA
CCCTGTACCTGAAATCATGCCCGCGTGGCACCCAAGAGGG
CCTGCTGCTCCCCCAACACCTGAAGCTTTACTCGTCCCAC
CTGCTTCGCTAATGGGTTCCTCTAGGAAACCTGTGTCTTC
TAAATCAACATCTTCTGACTGTTCATCCCAGTCAGTCCAC
TCTTCACCTCAAAAACAACCTGCTCCCATCGCTGTGCAAC
AAAACACTATTCATACCGAGACCTCGTCTCTTGAAAGGAC
AGTATCACAGCCAGTGTCCACTACACCAGGAGGCTCTACC
AGCCTCAAAACGCCCAGTCAAGAGGAATGTTTACATAGGA
ACCCCAATGCTGCTCATGCGGTTGCTCCATCTAAAGTGCC
CTTAGAGCCTCAGATGATCACTACGCACGTTCAGAGCTCA
ACCACTAGCGCTCCTAAACCTTGTGCTGCTGCGCCTGCAA
AGAGAGAGACCGAGCAGGTTGTTTTGGCCCCTGTGTGTGA
GCAAGCCAAAACCACCCTGCCAACTAATTCTAAAAAGCTG
ACCTCACGCTCACAGCCTCATGTTGCGCCAATAGCTGCTC
AGCCGTTTTTCACAGCTCAGGTTCAGGCCAGAGTTGTTGA
ATTGGCAGAGCAGATGAGGATGGCTTCTTCTGAGACCCCT
AAACCAAAGACTGCTACGGTTGAGCTGATTGAGTCTTTCA
CCAGTGAAATTGGTATTGAAGCAGCTGATCTTACGAGCCT
CTTGGAGCAGTTTGAAGAGTCTCAGCCCAAGGAAGAGACG
CGTGTACCGGAGGTCTGTGGTAGAGCAGCCGCTGTAGGAA
ACTCCAGTTTTGAGCAGGTGGAAACTAAAGCAGTTGAGAA
AACACGCAACCATGACCTGGGAAGCACAGCGGGTCTCACA
CCTCCAGCCACACCGCCACACCAGATGTGGAAGCCCATTG
CACCAGTTTCACTACTAGGAAAAACCAAGAAGTCAGAGGT
CCCTAAATCAACAACCAACAAGGCCATTCAGATAGAGGCA
AGACCACTGCCTTCAAATAAGCTGCGTTGCAAGCCTCAGA
CCCTTACCACCACTGGACAGACTCAACCTTTCTCCCTCGA
CCACGACTACTGCCTCCCTCCTAAAGAGCTCAGTCAAACT
GAAGTTGGCAGCCGGTGGAATGTTAAACAACAGCCTAGCA
TTGTTATCAAGACCGTTGAGCTGCCTTCTAACAAGCCGCT
GCAAAAGAATGTCTCCAAGACTTCTTCATCAACTTCTTCA
GTTACTGAAGAGACACAGAAGAATCTTAGCCTCAGTCAAC
CATCTGAAGGTACAAGCTGTACGCTAAACAGCTCTGTTCT
GGAGACTCCAGACGCTTCTCCAAACAGGCCTGACTCTGAA
AGCTCCTTACTCAATGAAGTGAACCACAAGAAATCTGTAG
ACTACTCCAAGTGTTCATCCACAAAGTACCAGCAGGACAG
AGGGCGTCAAAAACGAAGATACAGAGCCCCGTCCACTAGT
AGTTCAGAATCCAGCTCTGAATCCTCCTCCAGATCACGCT
CACCACCTAGGAAAAGATATAGGTCTCGACACTCAAGCAG
CAGATCCAGTTCCTCGTCTCGTTCCCGATCTAGCTCCAGG
TCATTTTCTCCACCTCGGCGTCGACGGTATTCCTACTCCA
GCTCACGTTCTGGATCCTGGAGCTGCAGCCGCTCTCGATC
CAGGTCCCGCTCTACTGATTCTCATGAACACCGTCACTGG
AGAAGTCGAAGAAGCCCTGATCAGAGGCCTGGATATCATC
ATGTTCAAAATAGCAGTGAGGATACAAAAAGGCGCAAAGA
GAAAGCCATTGAGGAGCGACGGGTTGTTTATGTTGGAAGA
ATTTGTGGAAACATGACTCGTATGGAGCTGAAAGAGCGCT
TCCTGTACTTTGGAGACATAGAGGAGTGCACCGTACACTT
TAGAGAAAATGGGGACAACTACGGTTTTGTCACATACTAC
AGCGTAAAGGATGCATTTAATGCTATTGAAAACGGAAGCA
TTCTGAGGAAGCCAAATGAGCTTCCATTTGACCTGTGCTT
TGGAGGGAGGCGGCAGTTTTGCAAGGCCAGCTATGCTGAT
CTTGATTCAAACCGAGAGTACGATCCAAAGCCTACAAAGG
GCAAATTTGATGCACTAGACTTCGACACTTTACTCAAGCA
GGCTCAGAAAAATCTGAAAAGGTAACGATTAGTCAAGCCA
CAGGAGAGAAGACGAATTACCTCGGAGCAAAATGCTGCCC
CACACTTCCAGTGTTGCCTCTCATTTACTGTTTTTTTTTT
ATTTTATTTTATTTTGTTTGTTTTGCTTTTCTTTGTTTTT
GTTTCTGCAAGTTTACACCTTCTATTGAAGTGAAGATTTG
TAAGAAAAATAGAAAGTGCAAAAAAAAAAATCATGAAATA
TAAACTATGGAATGGAAAAATAGTATTTTTTAAAAGGATT
GAATTTATTTAAATGTTTAATCTGAATTGATTGTTGGACA
CATTTTAAGAGGAATTGAATGGAAACATTATGTTGGGGTA
TAAAGATTTATAAACAAGTTCGTCAAGGTAAATAAACCCA
AGATGAAAGAATTTATTTGTGTTGACTTTTCTCAGATGTG
TTATTCTGTCTGCAATACTGTATAAAAATAAACTGAGTTT
CCCTTGATTTTACAGGAACTGAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations