ZFIN ID: ZDB-TSCRIPT-141209-681
Transcript Name: hnrnph1-201
Previous Name: hnrnph1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000060491 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000060491|OTTDARG00000041967|ZDB-GENE-040426-1856 hnrnph1|OTTDARP00000046746 hnrnph1-001 LG_none CU658205.6,CU855621.7 Danio rerio protein_coding KNOWN, 2011 bp
CGATTATCGTGTGTGAGCACTGTTCAGCCTTTCGTTTTTA
TTATTATTTTACACATTACAGACACACACGAGAAATACTG
TAGTGAATCACCTCATTAGAACATCACCTGGCATTGATTG
AAGTGACGAAGCGTCTTTGAGGGGGGTTTAATACAAGGGT
TGCTTCCAGCATGGCGGATGGAGAAGGTTTTGTGGTGAGA
GTCAGAGGTTTACCTTGGTCCTGCTCTGTTGATGAAGTTC
AGAGGTTTTTCTCAGAGTGCAAAATTGCAAGCAATGGGAC
AAGCATACACTTCACATACACACGGGAAGGTCGTCCAAGT
GGAGAGGCATTTGTCGAGTTTGAATCGGAGGAAGATCTCA
AAATTGCAGTGAAGAAAGATCGTGAAACCATGGGGCACCG
TTACGTAGAAGTATTCAAATCCAATAGTGTTGAGATGGAC
TGGGTTCTGAAGCACACCGGTCCAAACTGTCCAGAGACAG
GAGGTGACGGCCTGGTTAGGCTTCGAGGTTTGCCCTTTGG
ATGCAGCAAGGAGGAAATTGTCCAGTTTTTTGCAGGGTTG
GAAATCGTGCCAAATGGGATAACATTGCCGGTGGACTTCC
AGGGGAGGAGTACGGGGGAGGCCTTCGTGCAGTTTGCTTC
ACAGGATATAGCCGAAAAGGCTCTAAAGAAACACAAGGAA
AGAATAGGGCACAGGTATATAGAGATCTTCAAGAGCAGCC
GTGCGGAAGTACGCACACATTACGAACCCCAGCGAAAGGT
CATGGGCATGCAGAGACCGAGCCCCTATGATAGGCCAGGG
GGCGGCAGAGGATACAACAGCATGGGCAGAGGAGTCTCCT
TTGAGAGAATGAGACGTGGCGGCTACGGTGGAGATGGTCG
TTATGGAGACAGCGGCTCTTCCTTTCAGAGCACAACGGGA
CACTGTGTGCACATGAGAGGCCTTCCTTACAGAGCCACTG
AGACCGACATATACAATTTCTTTTCTCCGCTGAACCCGGT
GCGTGTGCATTTAGAGATTGGTCCTGATGGGAGAGTGACA
GGAGAGGCCGATGTAGAATTTGCCACACATGAGGACGCGG
TGGCTGCCATGTCCAAAGACAAAGCCAATATGCAGCACCG
TTATGTGGAGCTGTTCCTGAACTCCACAGCTGGAGGCGGA
AGTGGAGGATATGGTGGTCAAATGATGGGCGGTATGGGAA
ACCAGTCGTCATACGGACACAGCAGTCAGCAGATGGGCTC
AGGCTATGGTGGCGGTTACGCTAACCAGAGTGGCATGGGG
GGCTACAGTGACTACAGTGAGTGTCAGCTCTTCCGTAGCT
CCGCTAGCCGCTTCCATGCCAAATCCTATCGGCCTTGGAC
CCCTAAGGGTAGCTGTTTGTAATGCCTGATTTAAAAGCCT
TTCGTGTTGTCCTGTTGTAGCTGATCAGGTAATTCGGGCG
GATTAGGCGGCAGTTACTACGGCGGAGGAAGTCGCGGATC
CATGGGAATGAATGGTGGCTGGGGGATGTAGCGGCTCTAT
TTCAACATTGTGTCCTCTTTCATTGGTTTGTACTTTGTTC
CCCGCTCCCGTTCAAGTTGTGTTCGGAGCACAAGAGTTTT
CTGTTCCTTGTTGACATGTTATTTTGAAGTTTGTCATATT
CTTAAACGTGACACCCCTACGAGACGTGCCTGTGAATGTT
TTTACAGCATATTGATTTTAGTTTCCTCACCGGCCAATGT
TATCAAAGCCTTCACAAGTTGACGTCTTCGCACATGGAGG
TGATTGTAGCACATCATATCTATAAAATAGTTTGAGTGTT
TATGTTCAGGAGGGAATGAAAAGACTTTTGTATTATTTCA
AAGCATGATGGGAAGGGTTTTGTTAAGCTGCATGTTGCTT
TCTGTTTTCTTTCCCCAATCTACTGTGATTTCAGTGTGGT
CAACCAAGTTTACAAATGTCTGATTCCCTCATCTCTTCAC
AGAGTGATTAATACGTTTGCGGCAGTGTTTATTAAACCGT
ACACAATTCTA

hnrnph1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA hnrnph1-201 2011
hnrnph1-202 (1)    Ensembl 1956
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hnrnph1-201 Contained in:
[BAC] CH73-269I13 (1)
[Fosmid] ZFOS-1809E12 (1)

Genome Resources: Vega_Trans:OTTDART00000060491 (1),  Ensembl_Trans:ENSDART00000059918 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC154576 (1) 2034 nt
GenBank:BC065439 (1) 1957 nt
CITATIONS (2)