ZFIN ID: ZDB-TSCRIPT-141209-3124
Transcript Name: hnrnph1-202
Previous Name: hnrnph1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000060490 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000060490|OTTDARG00000041967|ZDB-GENE-040426-1856 hnrnph1|OTTDARP00000046745 hnrnph1-002 LG_none CU658205.6,CU855621.7 Danio rerio protein_coding KNOWN, 1956 bp
GAGTGCTGCAGTTTCACATCCCAAACAGCAGGTGTCGACA
AACGCAACTTTTAGTTCCCCAATCCAGTAAACAGCGACGA
TTATCGTGTGTGAGCACTGTTCAGCCTTTCGTTTTTATTA
TTATTTTACACATTACAGACACACACGAGAAATACTGTAG
TGAATCACCTCATTAGAACATCACCTGGCATTGATTGAAG
TGACGAAGCGTCTTTGAGGGGGGTTTAATACAAGGGTTGC
TTCCAGCATGGCGGATGGAGAAGGTTTTGTGGTGAGAGTC
AGAGGTTTACCTTGGTCCTGCTCTGTTGATGAAGTTCAGA
GGTTTTTCTCAGAGTGCAAAATTGCAAGCAATGGGACAAG
CATACACTTCACATACACACGGGAAGGTCGTCCAAGTGGA
GAGGCATTTGTCGAGTTTGAATCGGAGGAAGATCTCAAAA
TTGCAGTGAAGAAAGATCGTGAAACCATGGGGCACCGTTA
CGTAGAAGTATTCAAATCCAATAGTGTTGAGATGGACTGG
GTTCTGAAGCACACCGGTCCAAACTGTCCAGAGACAGGAG
GTGACGGCCTGGTTAGGCTTCGAGGTTTGCCCTTTGGATG
CAGCAAGGAGGAAATTGTCCAGTTTTTTGCAGGGTTGGAA
ATCGTGCCAAATGGGATAACATTGCCGGTGGACTTCCAGG
GGAGGAGTACGGGGGAGGCCTTCGTGCAGTTTGCTTCACA
GGATATAGCCGAAAAGGCTCTAAAGAAACACAAGGAAAGA
ATAGGGCACAGGTATATAGAGATCTTCAAGAGCAGCCGTG
CGGAAGTACGCACACATTACGAACCCCAGCGAAAGGTCAT
GGGCATGCAGAGACCGAGCCCCTATGATAGGCCAGGGGGC
GGCAGAGGATACAACAGCATGGGCAGAGGAGTCTCCTTTG
AGAGAATGAGACGTGGCGGCTACGGTGGAGATGGTCGTTA
TGGAGACAGCGGCTCTTCCTTTCAGAGCACAACGGGACAC
TGTGTGCACATGAGAGGCCTTCCTTACAGAGCCACTGAGA
CCGACATATACAATTTCTTTTCTCCGCTGAACCCGGTGCG
TGTGCATTTAGAGATTGGTCCTGATGGGAGAGTGACAGGA
GAGGCCGATGTAGAATTTGCCACACATGAGGACGCGGTGG
CTGCCATGTCCAAAGACAAAGCCAATATGCAGCACCGTTA
TGTGGAGCTGTTCCTGAACTCCACAGCTGGAGGCGGAAGT
GGAGGATATGGTGGTCAAATGATGGGCGGTATGGGAAACC
AGTCGTCATACGGACACAGCAGTCAGCAGATGGGCTCAGG
CTATGGTGGCGGTTACGCTAACCAGAGTGGCATGGGGGGC
TACAGTGACTACAGTAATTCGGGCGGATTAGGCGGCAGTT
ACTACGGCGGAGGAAGTCGCGGATCCATGGGAATGAATGG
TGGCTGGGGGATGTAGCGGCTCTATTTCAACATTGTGTCC
TCTTTCATTGGTTTGTACTTTGTTCCCCGCTCCCGTTCAA
GTTGTGTTCGGAGCACAAGAGTTTTCTGTTCCTTGTTGAC
ATGTTATTTTGAAGTTTGTCATATTCTTAAACGTGACACC
CCTACGAGACGTGCCTGTGAATGTTTTTACAGCATATTGA
TTTTAGTTTCCTCACCGGCCAATGTTATCAAAGCCTTCAC
AAGTTGACGTCTTCGCACATGGAGGTGATTGTAGCACATC
ATATCTATAAAATAGTTTGAGTGTTTATGTTCAGGAGGGA
ATGAAAAGACTTTTGTATTATTTCAAAGCATGATGGGAAG
GGTTTTGTTAAGCTGCATGTTGCTTTCTGTTTTCTTTCCC
CAATCTACTGTGATTTCAGTGTGGTCAACCAAGTTTACAA
ATGTCTGATTCCCTCATCTCTTCACAGAGTGATTAATACG
TTTGCGGCAGTGTTTATTAAACCGTACACAATTCTA

hnrnph1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA hnrnph1-201 (1)    Ensembl 2011
hnrnph1-202 1956
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hnrnph1-202 Contained in:
[BAC] CH73-269I13 (1)
[Fosmid] ZFOS-1809E12 (1)

Genome Resources: Vega_Trans:OTTDART00000060490 (1),  Ensembl_Trans:ENSDART00000157635 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH606089 (1) 828 nt
GenBank:CT643199 (1) 697 nt
CITATIONS (2)