Transcript

hnrnph1-202

ID
ZDB-TSCRIPT-141209-3124
Name
hnrnph1-202
Previous Names
  • hnrnph1-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000060490 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060490|OTTDARG00000041967|ZDB-GENE-040426-1856 hnrnph1|OTTDARP00000046745 hnrnph1-002 LG_none CU658205.6,CU855621.7 Danio rerio protein_coding KNOWN, 1956 bp
GAGTGCTGCAGTTTCACATCCCAAACAGCAGGTGTCGACA
AACGCAACTTTTAGTTCCCCAATCCAGTAAACAGCGACGA
TTATCGTGTGTGAGCACTGTTCAGCCTTTCGTTTTTATTA
TTATTTTACACATTACAGACACACACGAGAAATACTGTAG
TGAATCACCTCATTAGAACATCACCTGGCATTGATTGAAG
TGACGAAGCGTCTTTGAGGGGGGTTTAATACAAGGGTTGC
TTCCAGCATGGCGGATGGAGAAGGTTTTGTGGTGAGAGTC
AGAGGTTTACCTTGGTCCTGCTCTGTTGATGAAGTTCAGA
GGTTTTTCTCAGAGTGCAAAATTGCAAGCAATGGGACAAG
CATACACTTCACATACACACGGGAAGGTCGTCCAAGTGGA
GAGGCATTTGTCGAGTTTGAATCGGAGGAAGATCTCAAAA
TTGCAGTGAAGAAAGATCGTGAAACCATGGGGCACCGTTA
CGTAGAAGTATTCAAATCCAATAGTGTTGAGATGGACTGG
GTTCTGAAGCACACCGGTCCAAACTGTCCAGAGACAGGAG
GTGACGGCCTGGTTAGGCTTCGAGGTTTGCCCTTTGGATG
CAGCAAGGAGGAAATTGTCCAGTTTTTTGCAGGGTTGGAA
ATCGTGCCAAATGGGATAACATTGCCGGTGGACTTCCAGG
GGAGGAGTACGGGGGAGGCCTTCGTGCAGTTTGCTTCACA
GGATATAGCCGAAAAGGCTCTAAAGAAACACAAGGAAAGA
ATAGGGCACAGGTATATAGAGATCTTCAAGAGCAGCCGTG
CGGAAGTACGCACACATTACGAACCCCAGCGAAAGGTCAT
GGGCATGCAGAGACCGAGCCCCTATGATAGGCCAGGGGGC
GGCAGAGGATACAACAGCATGGGCAGAGGAGTCTCCTTTG
AGAGAATGAGACGTGGCGGCTACGGTGGAGATGGTCGTTA
TGGAGACAGCGGCTCTTCCTTTCAGAGCACAACGGGACAC
TGTGTGCACATGAGAGGCCTTCCTTACAGAGCCACTGAGA
CCGACATATACAATTTCTTTTCTCCGCTGAACCCGGTGCG
TGTGCATTTAGAGATTGGTCCTGATGGGAGAGTGACAGGA
GAGGCCGATGTAGAATTTGCCACACATGAGGACGCGGTGG
CTGCCATGTCCAAAGACAAAGCCAATATGCAGCACCGTTA
TGTGGAGCTGTTCCTGAACTCCACAGCTGGAGGCGGAAGT
GGAGGATATGGTGGTCAAATGATGGGCGGTATGGGAAACC
AGTCGTCATACGGACACAGCAGTCAGCAGATGGGCTCAGG
CTATGGTGGCGGTTACGCTAACCAGAGTGGCATGGGGGGC
TACAGTGACTACAGTAATTCGGGCGGATTAGGCGGCAGTT
ACTACGGCGGAGGAAGTCGCGGATCCATGGGAATGAATGG
TGGCTGGGGGATGTAGCGGCTCTATTTCAACATTGTGTCC
TCTTTCATTGGTTTGTACTTTGTTCCCCGCTCCCGTTCAA
GTTGTGTTCGGAGCACAAGAGTTTTCTGTTCCTTGTTGAC
ATGTTATTTTGAAGTTTGTCATATTCTTAAACGTGACACC
CCTACGAGACGTGCCTGTGAATGTTTTTACAGCATATTGA
TTTTAGTTTCCTCACCGGCCAATGTTATCAAAGCCTTCAC
AAGTTGACGTCTTCGCACATGGAGGTGATTGTAGCACATC
ATATCTATAAAATAGTTTGAGTGTTTATGTTCAGGAGGGA
ATGAAAAGACTTTTGTATTATTTCAAAGCATGATGGGAAG
GGTTTTGTTAAGCTGCATGTTGCTTTCTGTTTTCTTTCCC
CAATCTACTGTGATTTCAGTGTGGTCAACCAAGTTTACAA
ATGTCTGATTCCCTCATCTCTTCACAGAGTGATTAATACG
TTTGCGGCAGTGTTTATTAAACCGTACACAATTCTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations