header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-141209-657
Transcript Name: guf1-201
Previous Names: guf1-001, dkey-185e18.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000060418 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000060418|OTTDARG00000041911|ZDB-GENE-030131-4289 guf1|OTTDARP00000046691 DKEY-185E18.4-001 LG_ BX088718.8 Danio rerio protein_coding NOVEL, 2703 bp
TGACGTTTGACCAACATGGCGGCGCACTGTAGCTGTCACA
CTGGAGCGCACAATCGAGACCCAACTGTTTCTAATCACTG
AATGATTGTGTATTTTAATGTTACGATTCTTTTTCGGTCG
GAAAAGATCAAAATGCAATTTAACGTCATAACATCGCTTC
TATGTTCATGAATTACATGCCATTGAGTTGGTAGAGATGA
TGTCTCTATTGAGACCCCACGGGCTCTTTCTGCCCTTTAT
CAAACGCTTGACAGATATTAAAGTATGCCGCGTTAAACGC
AGGTCTCAGGGCTGCACCTATAACATTACAGTAATCAGAC
ACAGGTGGATGAAGAGCCTCGGTTCTGTCAGAGACCTCAG
CTCATCTGCGACTGAGAAGGAGACTTTCGACATGTCAAAG
TTTCCTGCGGAGAGAATTCGAAACTTCAGCATCATAGCTC
ACATTGATCATGGCAAGAGCACTTTAGCAGACCGACTGCT
GGAGATGACAGGAGCCATTGCAAAGACGGCAAGCAACAAG
CAGGTTCTGGATAAACTGCAGGTGGAGAGAGAACGAGGAA
TCACCGTTAAAGCTCAGACTGCTTCCCTTTTCTACCAGCA
CCACGGACAGACTTACCTGCTCAATCTCATCGACACACCG
GGCCATGTTGACTTCAGCTATGAAGTATCGCGGTCTATAT
CCGCATGCCAAGGAGTTCTGCTTATTGTAGATGCAAATCA
GGGAATTCAAGCCCAAACGGTTGCCAATTTCTACCTGGCA
TTTGAGGCTCAACTTGCAATCATCCCTGTAATAAACAAGA
TCGATTTGAAAAATGCTGATCCGGAGCGAGTGGAGAAACA
GATCGAAACAGTCTTTGATATTCCAAAGGAAGAGTGCATC
AGGATTTCTGCAAAACTGGGTACAAATGTGGAGCAAGTTC
TCCAAGAGGTGGTCAAGCGGATTCCTCCTCCAGCAGTGAG
AGTGGAGGATCCGTTTAAAGGCCTTGTCTTTGACTCCACC
TTCGACCATTACAGAGGAGTCGTGGCCAACATCGCTCTGT
TCGGTGGACGGGTGTCCAGAGGAGACAGAATCGTTTCTGC
CCACCTGGGAAAGTCATTTGAGGTCAATGAGCTGGGCATC
CTGAGACCCGACCAACACCCCACAGAAACACTGTATGCTG
GGCAGGTGGGTTATGTGATCGCAGGGATGAAGGAAGTGAA
GGAGGCTCAGATCGGAGACACGCTTTACCTCCATAAACAG
CCAGTGGAGGCGCTGCCGGGGTTCAAACCAGCCAAACCCA
TGGTATTTGCAGGCATGTATCCCATGGACCAGTCTGAATA
TACAGCCCTGCGCAGCGCTTTGGAGAAACTGACGCTCAAT
GATTCCAGCGTGAGCATTCAGAAAGACAGCAGTCTGGCTC
TGGGGGCCGGATGGAGGCTGGGTTTTCTGGGTTTGCTGCA
CATGGAGGTGTTTAACCAGCGTTTAGAGCAGGAGTACAAC
GCATCTGTCATAATAACAGCACCAACTGTACCATACAAGG
CTGTGCTGGCATCTGCCAAACTCATAAAGGAATATGGTGA
GGAAGTGATCACCATCATCAACCCTGCTCAGTTCCCTGAT
AAGTCGAAGGTGCTGGAGTATCTGGAGCCTATGGTGACGG
GAACCATCATCACTCCGGACGACTTCACTGGGAAGATCAT
GACTCTGTGTCAGGGTCGCAGGGGCATTCAGAAGAACATG
GTCTACATTGATGACCACCGGGTGATGATGAAGTACGTTT
TCCCTCTAAATGAGATTGTGGTGGACTTTTATGACCAGCT
CAAGTCCATGTCATCAGGATACGCCAGTTTTGATTATGAG
GACGCTGGATATGAGGCCGCTGATTTGATTAAGATGGACT
TTCTACTCAACGGGCAACCAGTGGAGGAACTCGCTGTTAT
CGTTCATAAAGATAAAGCGTACAGTTCGGGCAAAGCCATA
TGTGAGAGACTGAGCAATTCCATTCCCAGACAAATGTTTG
AGATCGCAGTGCAGGCCGCCATCGGCAGCAAGATCATCGC
TCGAGAAACGATCAAAGCTTTCCGAAAGAATGTTCTTGCA
AAATGTTACGGCGGTGACATTACCCGAAAAATGAAACTAC
TCAAGAAGCAGGCTGAGGGAAAGAAGAAAATGCGGCGCAT
TGGAAACATCGACGTCCCAAAAGACGCTTTCATCAGTGTT
CTGAAGCGGAAGTAGTTCATAATCATCAGACATTAAAACT
CCGGCGTGTTCGTGTCCATAAATCAAGCCTATGGACAGAA
CGGGGAGTGATTTAGAAACGCTTTATAGCTTCATATAACT
AAGTGATGTTATTCTGGGAACCCACAGCAGGTTTTGATGG
ATTAATCTTCATGGTGGAAACAACACTGCAGTTCTCGCAG
GAGCAGAGACTGCAAGCTAAGGGGTTTTCACTGGAGACGT
TTAGACTGAGCGAATGCAGAAGTCATTGGCGGAACTCCTT
TACTTTGAAAACATTTATTTTATTTTCATCAACTGCTGAG
GGAGTCGCCGTGAACGTAAAGCTGAAAGCAATCCAGCTTG
GGTTTGTTGAAACATTTCTGAGAGTTTGAGGGAAAAAGTG
CTGCGTCTAAATGAATAGTCCACCTAAAACGTGAACTAAA
CGTTTACTTTAAAATTTTCTGAGTCTGTTTCTGCTGTTGA
ACACAAAAATAAGATATTTTGAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
guf1-201 Contained in:

OTHER guf1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000060418 (1)
  • Ensembl_Trans:ENSDART00000042672 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DY568862 (1) 736 bp
    GenBank:CK699008 (1) 709 bp
    GenBank:CO349715 (1) 680 bp
    GenBank:EB840589 (1) 513 bp
    GenBank:EB899262 (1) 483 bp
    GenBank:AI965189 (1) 217 bp
    CITATIONS (2)