Transcript

camk1b-201

ID
ZDB-TSCRIPT-141209-604
Name
camk1b-201
Previous Names
  • camk1b-001
  • ch211-236d3.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000060202 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060202|OTTDARG00000041772|ZDB-GENE-141014-1 camk1b|OTTDARP00000046526 CH211-236D3.2-001 LG_none BX571768.19,BX248331.8 Danio rerio protein_coding NOVEL, 5243 bp
GTGACGTCATGGGGCAGCGCTGACAGACTGGGTCAGTGAG
AGGAACCAGCAGTCAGAGCTGCGAGACCAGTGCAAGACGC
GGTTCTGCACCTCTCCGGTTTACAGTTTCTCCATCATCGA
CCGTAGCAAAATGCCCCTGGGAGAGGATGGACCCTCTTGG
AAAAAGAAAACAGCGAACATCAAGGATATCTATGACTTCA
AAGAGGTTTTGGGCACAGGGGCTTTTTCTGAGGTGATGCT
CGCTGAGGAGAAGAGGACGAGGAAACTGGTGGCCGTAAAG
TGCATAGCCAAAAAAGCTCTGGAGGGAAAGGAGAACAGCA
TTGAAAATGAGATCGCCGTCCTCCACAAGATTAAACATGC
CAACATAGTATCCCTGGAGGACATCTTTGAGAGTAAATCA
CACCTCTACCTTGTCATGCAACTAGTGTCTGGCGGCGAAC
TCTTCGACAGGATTGTGGAAAAAGGATTTTACACTGAGAA
AGATGCCAGTAAGCTCATCCAGCAGATCCTGGACGCCGTC
AAATACCTGCATGACATGGGCATTGTGCACAGAGACCTGA
AGCCGGAGAACCTGCTGTATTACAGTATGGATGAAGAATC
CAAGATCATGATCAGTGATTTTGGCCTGTCAAAGATTGAG
GGTTCGGGCAGTGTGATGAGCACGGCGTGTGGCACTCCAG
GATATGTAGCTCCTGAGGTCTTGGCGCAGAAGCCGTACAG
TAAAGCGGTGGACTGCTGGTCAATCGGGGTCATCGCTTAC
ATCCTATTATGTGGCTATCCCCCCTTTTACGATGAGAATG
ATGCCAAGCTCTTTGAGCAGATCCTGAGGGCCGAATACGA
GTTTGATTCACCTTATTGGGATGATATATCTGATTCGGCC
AAAGATTTTATTGTCCATTTAATGGAAAAAGATCCCAATC
AGCGTTACACGTGTGAACAAGCCCTTCAGCACCCATGGAT
TGCTGGAGACACGGCCCTGGATAAGAACATCCATGAATCT
GTCAGTGCCCAAATTAAGAAGAACTTTGCCAAAAGCAAGT
GGAAGCAAGCGTTTAATGCCACAGCAGTGGTCCGGCACAT
GCGCAGGCTGCAGTTGGGCACCAGTCAGGAGGGTCCGCCG
CAGAACACACTGCCCAGCCCATGCCATGGTCACCTGCTGC
TGCCCGAGGGGGACGAGGACGACAGCGTGAGGGAAAACAG
CGGCTGTTCTGAGGGCGTCAGTGACGGGAACGACATCCAG
AACTGCAGCTACCACCTCCACCCTACTAGCCGGGTCTGAG
TGTCAATCATCCTGAAACAACCAATGACTGACTGTCCTGT
TTTATTTTTCCCACCGGAGTCCTGCCACACCCCTCAGGTC
TGGCCAGGAAACACTGCGTTGCTCCAGCATCCTGCCACTT
GGAGGCGCTGCAGTGTAAAGAAACCAGGTGGGGGAAACGG
GGTCACTACTATTCCAATGGAGAGAGAGAGTCTGTTTAGT
GAGAGGTCGGGAACGAAAAGAGACCGGAAGATTGCTATTG
GAGCTTCGTGGGGGTATATATATGCTATTGTGGGAGCCGG
ATAAAGATTGGACAGTGTTTTAACTCTTTATTTTAAGAAC
AACTACTCTGTCTGGTTTTCTTTTTCTTTTTCAGAACTAA
AAGATGTGCACGGGCCTGCTTCTGTTTTAATTCTTAAAGT
TGTTGCCACAGTTGTTGTTGTTGAGATGTGGCTTAGTTTA
TTAGAGATACAAGTTTGGAATCAGTATAATTTGTCTCAGT
GTTTTATAATCAGCTTATTTTGCTCACAAATGCTGCATTT
ATTTGATTAAATTAAATAGTTTGTGAAATGTTATTGCAGT
GTTACTGTAAATAACTGATATTTTATTGAATGTACACTGC
AAAAGATCCAGAAATCATTTGCTTACCCCATTGACAGATT
ATTTAGCTTTTTTTAGGGGAAAAAAAACACTTTATTTTGA
TGCATTATTTTTAAAGCAAGACTATATAATTATTAATAAT
TAATAATAATTAAAATAATAAATAATAATATATTAATATT
AAAATGTAATCAATAAAATGTAATTATTATTAATTTTAGG
TGGTTTAATGCAGAATTTTAAGCTTGGTTAGTTACATAAT
GCTTCAAATATTCTAGTATCATGAATATTCTGCTCTCGAA
GATTGTTGTTAATGTAATTGTTGTCGGTTTGGAAAGCAAA
CTAAAACGTTTGTTTTAAAAAACGTTTTAAAAAGTACCAA
AATAAAAATTAAATAAACATTTATATACCTTTATTCATTA
CAATAAATTGTTCAAGAGCAAAAATACATCTTTATAATGT
AAAAAAAAAAAAGATAGCGAATGAAAGCTGTTGTTTTTTA
CTTTCTTTTTTTAAAACGTATCACAGTTTCCATCTTGACA
AAAAAAAAGTCTGCATTATTTTGATAATTTTCCGATCATT
TTAAGTATTATTATTTTAAAAAGTTTTTGTCTTGTTTCTA
GTCTAAATATCTAAAAATTCTTAAATCAAGAAGTATTTTA
TAGACAAGTAAAATATATTGTGTTGATTTCAGAAATAATA
CATCAAAATTAAGTGAGTTTTCCCTTAAAATAAGCAAAAT
GATCTTGTTTTTGCTTTGACAAGATTATTACCCCATGTGC
AAATTATGTTTGCTTGTTTTTTTTTGGCATTTGGTCTAAA
AACAAGACAACATTTTTTTTTTAATAAGAAAAGCATTTTT
TGAGGTGAAGTTTAAAATGTTTTTAATTACATTTAATTAT
TTTTAATTCTTGTGGTTGAAAGCTGAATTTCAAGCTTTTA
CGTAATCCTTCAAATATTCTAGTGTCATGTTCTGCTCAAA
AACAAACATTATTATTATGATTATTATTATTATTATGATT
ATTATTTGTTGTTGTTGTTGGTTTGGAAAATAATATAATT
CAAAATTACCATAATAAAAATTAAATAAACATTTGTTTAC
CTTATGCCTCACAATAAATTGTTCAAGAGCAAAAATAGAT
CTTTTTGTTTAAAAAACGATAACAAATAAAAGCTGTTATT
TTGAACTTTCTTTCTTTTTTTAATCAAAAAAGCCTAAACA
TAAAATGTTTCACAGTTTCCATCTTATATAAAACAAGACA
AAAAATTAAAATAAAATCAGCGCTGATACTTGTGAAATCA
TTATTATACTGCACAAATAATGCTTTACTTTCTTAAAGTT
TGTCTCGTATCAAGTTCAAACATCTAAAAGTTCTTAAATC
AACTCAATAATAAGTCAAATAATAATAAATAAGTCAAAAT
AATCTTGTTTTTTGCTTTCACTTAAGTTTATTCAGCTTGT
TTTAAGGAAAAACTCGCTTCATTTTGAAATGAAGTATAAA
AGCAGAAGCTTTTTTCTAGTTCAAGTATCAAACAATTCTT
AAATCAAGAAGCATTTTCTTGTTTAAAACATAAAATGTAA
TTTTTTAAAAGTAATAGTAACTAAAAAAAATATTGTCCTT
TTTTAGCAAAGAAAAAAATCTAAAGTTTACCTCAAAACAG
ACTAAATAATCTGCCAATAGGGTAAGTAAAATAATTTAAC
TTCAAAGCGCATAAACAATATTCCCAATGGCAGATTATTT
TGCTTGTTTTACTCAAAAACTCACTTATTTTCAACACATT
ATATCTAAAAACAAGTCAACATTGTTTGCTTGTCTAGCAA
AAGCTAATTGATTTAATCCATTTTAGTTATTTGGACTAGA
AACAAGACAAGCTTAGTGTAGTGATTTTGCATGAATAACA
ACTGATTATAACATGAGCAAATCATCATACTGTAATGATT
TCTGAGACTGAAGTAAAGAAAGCTGAAGAAAATTCAGCTT
TGAATTGCTTAAGTAAATTACATTTGAAACTACACTGGAT
AAGAAAACACTCACTGTTTTCAACAAACTTGTATAATATT
TCACCGTTTAACAGCTTTCACGGTGTGTTTTAACAAATAA
ATGCAGCCTTGGTGAGCAGAATAGCCTTCTTTTAAAACTA
AATTGTAATGTTAACATTTAATGAGATGATTTCTGACATT
AGGTTATGCTAGAATGCACATCTCAAACATCAACTATTCC
TTCTTTTTCAACTAGCAGACTTCACATCCATCAGATTCTA
CATATTAGTCATGTTGCCAGATCCTCATAAGACGCACTGA
TGGAGTGTACATTACATTTTAAAACATTTAAAATGCTTTT
AAACATTTAATGTTGTTGTTTTTTTTGTGCACTAAGTCTG
CTCGACAGGTCACGAGTTCATTGTCAGTATGTCCAAGAGC
GTCTTTCTCGCTTCAGATGTCTTCTGTGGTGCCTTCATGC
ATTCAGTATCAACGTTTTACTTCATTTTGTGTTCAGATAT
ATTTAGGTTTGGGAATGTCGGACGCTGTATTTCTCGTTAA
CACATTGCTGTTTACCGGCACATTCACCTACAGTACATGG
CATGAACAGCTATGCAATGTCGGTGGACGCTTTTGGAAAT
GTCTAATGTTTAATGCTGCCATTCTGTAAATACTGCTAAA
CTTTTATTTATTTATTTTATTTTTTGGTAAACCCCTTTCT
ATTATAGCATAAAAACACTCAGGGGAGGAATAGAAATCAG
ATTTTGATATATTTAATGATCGTTTTACAAGTAAATATAT
ATATAAAGTATGCTTAAAGGGGACCTATTATGCAAAATAC
ACTTTTATAAGGGGTTTAAACACAGCAGTGTGTGAATAAA
GCCAGACTCTAATGGTCAACATTTATTAATTGTATTTTTT
ATAATCACACTTGATAAAATTCTCCTTTATGCATGTCATC
AAAGGAGGAAAGCCACGCCCATTACTGACGATTTCTCCCT
CATTAGCATAAACAGCCCTGAGTGAGAAGCAGTCGCAGGG
CATTAGAGTTTTGAATCTGCCACTATGCTGACATATAGGC
ACTCATAGCTCCGCCCTCTTTTAAAAAGAGCACAATCTGA
TTTGAATTTAAAGGGACAGTCACCAAACGGCACAATTTAT
ATCATGGCCTAAAAGGGGCAATTGTAAAGCATTATTTGTG
TGGTATTTTGAGCTGAAACTTTACATAGGGACATCAGAGA
TGTATTTTTCTTTCTTGTAAAAAAGGGGCATAATAGGTCC
CCTTTAATACATGTCACTATGAGGCTGTGCTCCAAACTCT
ATAACTTTTATTTTGTTTCTTCTTTTCAATGTTGGAACCT
GTATGAAAGTAACCTCCATTAAATGACATGAATGTGTGAC
TTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations