ZFIN ID: ZDB-TSCRIPT-141209-604
Transcript Name: camk1b-201
Previous Names: camk1b-001, ch211-236d3.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000060202 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000060202|OTTDARG00000041772|ZDB-GENE-141014-1 camk1b|OTTDARP00000046526 CH211-236D3.2-001 LG_none BX571768.19,BX248331.8 Danio rerio protein_coding NOVEL, 5243 bp
GTGACGTCATGGGGCAGCGCTGACAGACTGGGTCAGTGAG
AGGAACCAGCAGTCAGAGCTGCGAGACCAGTGCAAGACGC
GGTTCTGCACCTCTCCGGTTTACAGTTTCTCCATCATCGA
CCGTAGCAAAATGCCCCTGGGAGAGGATGGACCCTCTTGG
AAAAAGAAAACAGCGAACATCAAGGATATCTATGACTTCA
AAGAGGTTTTGGGCACAGGGGCTTTTTCTGAGGTGATGCT
CGCTGAGGAGAAGAGGACGAGGAAACTGGTGGCCGTAAAG
TGCATAGCCAAAAAAGCTCTGGAGGGAAAGGAGAACAGCA
TTGAAAATGAGATCGCCGTCCTCCACAAGATTAAACATGC
CAACATAGTATCCCTGGAGGACATCTTTGAGAGTAAATCA
CACCTCTACCTTGTCATGCAACTAGTGTCTGGCGGCGAAC
TCTTCGACAGGATTGTGGAAAAAGGATTTTACACTGAGAA
AGATGCCAGTAAGCTCATCCAGCAGATCCTGGACGCCGTC
AAATACCTGCATGACATGGGCATTGTGCACAGAGACCTGA
AGCCGGAGAACCTGCTGTATTACAGTATGGATGAAGAATC
CAAGATCATGATCAGTGATTTTGGCCTGTCAAAGATTGAG
GGTTCGGGCAGTGTGATGAGCACGGCGTGTGGCACTCCAG
GATATGTAGCTCCTGAGGTCTTGGCGCAGAAGCCGTACAG
TAAAGCGGTGGACTGCTGGTCAATCGGGGTCATCGCTTAC
ATCCTATTATGTGGCTATCCCCCCTTTTACGATGAGAATG
ATGCCAAGCTCTTTGAGCAGATCCTGAGGGCCGAATACGA
GTTTGATTCACCTTATTGGGATGATATATCTGATTCGGCC
AAAGATTTTATTGTCCATTTAATGGAAAAAGATCCCAATC
AGCGTTACACGTGTGAACAAGCCCTTCAGCACCCATGGAT
TGCTGGAGACACGGCCCTGGATAAGAACATCCATGAATCT
GTCAGTGCCCAAATTAAGAAGAACTTTGCCAAAAGCAAGT
GGAAGCAAGCGTTTAATGCCACAGCAGTGGTCCGGCACAT
GCGCAGGCTGCAGTTGGGCACCAGTCAGGAGGGTCCGCCG
CAGAACACACTGCCCAGCCCATGCCATGGTCACCTGCTGC
TGCCCGAGGGGGACGAGGACGACAGCGTGAGGGAAAACAG
CGGCTGTTCTGAGGGCGTCAGTGACGGGAACGACATCCAG
AACTGCAGCTACCACCTCCACCCTACTAGCCGGGTCTGAG
TGTCAATCATCCTGAAACAACCAATGACTGACTGTCCTGT
TTTATTTTTCCCACCGGAGTCCTGCCACACCCCTCAGGTC
TGGCCAGGAAACACTGCGTTGCTCCAGCATCCTGCCACTT
GGAGGCGCTGCAGTGTAAAGAAACCAGGTGGGGGAAACGG
GGTCACTACTATTCCAATGGAGAGAGAGAGTCTGTTTAGT
GAGAGGTCGGGAACGAAAAGAGACCGGAAGATTGCTATTG
GAGCTTCGTGGGGGTATATATATGCTATTGTGGGAGCCGG
ATAAAGATTGGACAGTGTTTTAACTCTTTATTTTAAGAAC
AACTACTCTGTCTGGTTTTCTTTTTCTTTTTCAGAACTAA
AAGATGTGCACGGGCCTGCTTCTGTTTTAATTCTTAAAGT
TGTTGCCACAGTTGTTGTTGTTGAGATGTGGCTTAGTTTA
TTAGAGATACAAGTTTGGAATCAGTATAATTTGTCTCAGT
GTTTTATAATCAGCTTATTTTGCTCACAAATGCTGCATTT
ATTTGATTAAATTAAATAGTTTGTGAAATGTTATTGCAGT
GTTACTGTAAATAACTGATATTTTATTGAATGTACACTGC
AAAAGATCCAGAAATCATTTGCTTACCCCATTGACAGATT
ATTTAGCTTTTTTTAGGGGAAAAAAAACACTTTATTTTGA
TGCATTATTTTTAAAGCAAGACTATATAATTATTAATAAT
TAATAATAATTAAAATAATAAATAATAATATATTAATATT
AAAATGTAATCAATAAAATGTAATTATTATTAATTTTAGG
TGGTTTAATGCAGAATTTTAAGCTTGGTTAGTTACATAAT
GCTTCAAATATTCTAGTATCATGAATATTCTGCTCTCGAA
GATTGTTGTTAATGTAATTGTTGTCGGTTTGGAAAGCAAA
CTAAAACGTTTGTTTTAAAAAACGTTTTAAAAAGTACCAA
AATAAAAATTAAATAAACATTTATATACCTTTATTCATTA
CAATAAATTGTTCAAGAGCAAAAATACATCTTTATAATGT
AAAAAAAAAAAAGATAGCGAATGAAAGCTGTTGTTTTTTA
CTTTCTTTTTTTAAAACGTATCACAGTTTCCATCTTGACA
AAAAAAAAGTCTGCATTATTTTGATAATTTTCCGATCATT
TTAAGTATTATTATTTTAAAAAGTTTTTGTCTTGTTTCTA
GTCTAAATATCTAAAAATTCTTAAATCAAGAAGTATTTTA
TAGACAAGTAAAATATATTGTGTTGATTTCAGAAATAATA
CATCAAAATTAAGTGAGTTTTCCCTTAAAATAAGCAAAAT
GATCTTGTTTTTGCTTTGACAAGATTATTACCCCATGTGC
AAATTATGTTTGCTTGTTTTTTTTTGGCATTTGGTCTAAA
AACAAGACAACATTTTTTTTTTAATAAGAAAAGCATTTTT
TGAGGTGAAGTTTAAAATGTTTTTAATTACATTTAATTAT
TTTTAATTCTTGTGGTTGAAAGCTGAATTTCAAGCTTTTA
CGTAATCCTTCAAATATTCTAGTGTCATGTTCTGCTCAAA
AACAAACATTATTATTATGATTATTATTATTATTATGATT
ATTATTTGTTGTTGTTGTTGGTTTGGAAAATAATATAATT
CAAAATTACCATAATAAAAATTAAATAAACATTTGTTTAC
CTTATGCCTCACAATAAATTGTTCAAGAGCAAAAATAGAT
CTTTTTGTTTAAAAAACGATAACAAATAAAAGCTGTTATT
TTGAACTTTCTTTCTTTTTTTAATCAAAAAAGCCTAAACA
TAAAATGTTTCACAGTTTCCATCTTATATAAAACAAGACA
AAAAATTAAAATAAAATCAGCGCTGATACTTGTGAAATCA
TTATTATACTGCACAAATAATGCTTTACTTTCTTAAAGTT
TGTCTCGTATCAAGTTCAAACATCTAAAAGTTCTTAAATC
AACTCAATAATAAGTCAAATAATAATAAATAAGTCAAAAT
AATCTTGTTTTTTGCTTTCACTTAAGTTTATTCAGCTTGT
TTTAAGGAAAAACTCGCTTCATTTTGAAATGAAGTATAAA
AGCAGAAGCTTTTTTCTAGTTCAAGTATCAAACAATTCTT
AAATCAAGAAGCATTTTCTTGTTTAAAACATAAAATGTAA
TTTTTTAAAAGTAATAGTAACTAAAAAAAATATTGTCCTT
TTTTAGCAAAGAAAAAAATCTAAAGTTTACCTCAAAACAG
ACTAAATAATCTGCCAATAGGGTAAGTAAAATAATTTAAC
TTCAAAGCGCATAAACAATATTCCCAATGGCAGATTATTT
TGCTTGTTTTACTCAAAAACTCACTTATTTTCAACACATT
ATATCTAAAAACAAGTCAACATTGTTTGCTTGTCTAGCAA
AAGCTAATTGATTTAATCCATTTTAGTTATTTGGACTAGA
AACAAGACAAGCTTAGTGTAGTGATTTTGCATGAATAACA
ACTGATTATAACATGAGCAAATCATCATACTGTAATGATT
TCTGAGACTGAAGTAAAGAAAGCTGAAGAAAATTCAGCTT
TGAATTGCTTAAGTAAATTACATTTGAAACTACACTGGAT
AAGAAAACACTCACTGTTTTCAACAAACTTGTATAATATT
TCACCGTTTAACAGCTTTCACGGTGTGTTTTAACAAATAA
ATGCAGCCTTGGTGAGCAGAATAGCCTTCTTTTAAAACTA
AATTGTAATGTTAACATTTAATGAGATGATTTCTGACATT
AGGTTATGCTAGAATGCACATCTCAAACATCAACTATTCC
TTCTTTTTCAACTAGCAGACTTCACATCCATCAGATTCTA
CATATTAGTCATGTTGCCAGATCCTCATAAGACGCACTGA
TGGAGTGTACATTACATTTTAAAACATTTAAAATGCTTTT
AAACATTTAATGTTGTTGTTTTTTTTGTGCACTAAGTCTG
CTCGACAGGTCACGAGTTCATTGTCAGTATGTCCAAGAGC
GTCTTTCTCGCTTCAGATGTCTTCTGTGGTGCCTTCATGC
ATTCAGTATCAACGTTTTACTTCATTTTGTGTTCAGATAT
ATTTAGGTTTGGGAATGTCGGACGCTGTATTTCTCGTTAA
CACATTGCTGTTTACCGGCACATTCACCTACAGTACATGG
CATGAACAGCTATGCAATGTCGGTGGACGCTTTTGGAAAT
GTCTAATGTTTAATGCTGCCATTCTGTAAATACTGCTAAA
CTTTTATTTATTTATTTTATTTTTTGGTAAACCCCTTTCT
ATTATAGCATAAAAACACTCAGGGGAGGAATAGAAATCAG
ATTTTGATATATTTAATGATCGTTTTACAAGTAAATATAT
ATATAAAGTATGCTTAAAGGGGACCTATTATGCAAAATAC
ACTTTTATAAGGGGTTTAAACACAGCAGTGTGTGAATAAA
GCCAGACTCTAATGGTCAACATTTATTAATTGTATTTTTT
ATAATCACACTTGATAAAATTCTCCTTTATGCATGTCATC
AAAGGAGGAAAGCCACGCCCATTACTGACGATTTCTCCCT
CATTAGCATAAACAGCCCTGAGTGAGAAGCAGTCGCAGGG
CATTAGAGTTTTGAATCTGCCACTATGCTGACATATAGGC
ACTCATAGCTCCGCCCTCTTTTAAAAAGAGCACAATCTGA
TTTGAATTTAAAGGGACAGTCACCAAACGGCACAATTTAT
ATCATGGCCTAAAAGGGGCAATTGTAAAGCATTATTTGTG
TGGTATTTTGAGCTGAAACTTTACATAGGGACATCAGAGA
TGTATTTTTCTTTCTTGTAAAAAAGGGGCATAATAGGTCC
CCTTTAATACATGTCACTATGAGGCTGTGCTCCAAACTCT
ATAACTTTTATTTTGTTTCTTCTTTTCAATGTTGGAACCT
GTATGAAAGTAACCTCCATTAAATGACATGAATGTGTGAC
TTG

camk1b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA camk1b-201 5243
ncRNA camk1b-002 (1)    Ensembl 495
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
camk1b-201 Contained in:
[BAC] CH211-236D3 (1), DKEYP-2C4 (1)

Genome Resources: Vega_Trans:OTTDART00000060202 (1),  Ensembl_Trans:ENSDART00000041417 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH115371 (1) 918 nt
GenBank:CT685683 (1) 895 nt
GenBank:DV594277 (1) 855 nt
GenBank:DN856493 (1) 756 nt
GenBank:EB891011 (1) 547 nt
GenBank:EB887823 (1) 531 nt
GenBank:EB945065 (1) 402 nt
CITATIONS (2)