ZFIN ID: ZDB-TSCRIPT-141209-1828
Transcript Name: camk1b-002
Previous Name: ch211-236d3.2-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000060203 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000060203|OTTDARG00000041772|ZDB-GENE-141014-1 camk1b|no_translation CH211-236D3.2-002 LG_none BX571768.19,BX248331.8 Danio rerio protein_coding NOVEL, 495 bp
AGTCAGAGCTGCGAGACCAGTGCAAGACGCGGTTCTGCAC
CTCTCCGGTTTACAGTTTCTCCATCATCGACCGTAGCAAA
ATGCCCCTGGGAGAGGATGGACCCTCTTGGAAAAAGAAAA
CAGCGAACATCAAGGATATCTATGACTTCAAAGAGGTTTT
GGGCACAGGGGCTTTTTCTGAGGTGATGCTCGCTGAGGAG
AAGAGGACGAGGAAACTGGTGGCCGTAAAGTGCATAGCCA
AAAAAGCTCTGGAGGGAAAGGAGAACAGCATTGAAAATGA
GATCGCCGTCCTCCACAAGTGAGTCATTCATACAGCTGTT
CCACTTCACTTACAGATATACAGATGACACACACACACAC
ACACTGTTCGATGTAAAATACAGACTGTGGAATGTATTTT
TAACAGAAATATTCTGTAGATAAAATTTTTGATTGAAAAA
TGTTAAAAACAGTAGATTACTGGCAACCACAGCTGCCGGT
ATTTTTCAGTAAAAT

camk1b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA camk1b-201 (1)    Ensembl 5243
ncRNA camk1b-002 495
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
camk1b-002 Contained in:
[BAC] CH211-236D3 (1), DKEYP-2C4 (1)

Genome Resources: Vega_Trans:OTTDART00000060203 (1),  Ensembl_Trans:ENSDART00000161338 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH446329 (1) 504 nt
GenBank:EH472188 (1) 504 nt
CITATIONS (2)