Transcript

camk1b-002

ID
ZDB-TSCRIPT-141209-1828
Name
camk1b-002
Previous Names
  • ch211-236d3.2-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000060203 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060203|OTTDARG00000041772|ZDB-GENE-141014-1 camk1b|no_translation CH211-236D3.2-002 LG_none BX571768.19,BX248331.8 Danio rerio protein_coding NOVEL, 495 bp
AGTCAGAGCTGCGAGACCAGTGCAAGACGCGGTTCTGCAC
CTCTCCGGTTTACAGTTTCTCCATCATCGACCGTAGCAAA
ATGCCCCTGGGAGAGGATGGACCCTCTTGGAAAAAGAAAA
CAGCGAACATCAAGGATATCTATGACTTCAAAGAGGTTTT
GGGCACAGGGGCTTTTTCTGAGGTGATGCTCGCTGAGGAG
AAGAGGACGAGGAAACTGGTGGCCGTAAAGTGCATAGCCA
AAAAAGCTCTGGAGGGAAAGGAGAACAGCATTGAAAATGA
GATCGCCGTCCTCCACAAGTGAGTCATTCATACAGCTGTT
CCACTTCACTTACAGATATACAGATGACACACACACACAC
ACACTGTTCGATGTAAAATACAGACTGTGGAATGTATTTT
TAACAGAAATATTCTGTAGATAAAATTTTTGATTGAAAAA
TGTTAAAAACAGTAGATTACTGGCAACCACAGCTGCCGGT
ATTTTTCAGTAAAAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations