ZFIN ID: ZDB-TSCRIPT-141209-602
Transcript Name: dnajc16l-202
Previous Names: dkey-33m11.9-001, dnajc16l-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000060196 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000060196|OTTDARG00000041770|ZDB-GENE-130530-696 dnajc16l|OTTDARP00000046522 DKEY-33M11.9-001 LG_ CR558302.9 Danio rerio protein_coding NOVEL, 5111 bp
CTTCACTCTGTAAAACGTATAGGCCTGCGTTTGCACAGAT
TTCAGAAACATTTGGGGATGAAGGGCGACATCTTTAACGT
CTACCTCTCGGTGGCTTCATATTTCAGTTACTCTGAACTG
TAAAGCCCGCCAATTATGTAAATGTGCGGGGCCATCCAAT
GGTGACTTGTTTGGTAACCTCATGTGGTGTTGATTCGTCC
TAATTAAATCAGGCAAAAACTGTTAAGTAAACAGTTAAGC
GTGCATTTCCCACAGACTGACTTACAGTTCGTATGTTGAA
ATTGGGCAGTTGTTTCATTTACTGGCAATTATAAAATATG
TTTTCAGAAACCTTGCAATTTTTTCTCCTCAAAAGAACAA
ACCGGAACAAACGACGTACAAGTCATGTGATTTTGCCACG
CGTGGATACATCATGAAATTTCGAGAACGCTTTGCTGATA
AGTTTTACCAGAAGCCCTTACTACCGGAAGCACCGGGGAA
GCGAAAGCCTGGGGGACGATCCATCTATTACCACCGGGAA
AACATGGATTGTTGCTAAATTCTGGATAGATACGATTACA
ACAAGAGTCGTGTCAAGTCTGTCGCAGTTCATGTATCAGA
AGATGGGAGGCTGGAGTGTTTTTGTGAGCTGCTGTGCTTG
GGCGATTCTTCTTCTTGCTCTGTTTGGTGATTCATTGGCA
TCTGCACCCGAGTTTGATCCGTACAGTGTTCTCGGAGTGT
CTAAACATGCAAGCCTCACTGAAATCAAGAAAATGTACAA
GAAACTGGCAAGAGAATGGCATCCAGACAAGAACAAAAGT
CCAGGTGCAGAAGACATGTTTATCAAGATCACCAAATCTT
ATGAGATTTTATCAAATGAGGAGCGAAGGGCGAACTATGA
TCGTTTTGGTCAAATGGATGAGAATCAAAACTTTGCGCGG
CCGCCGCAGGGCTTCAGACAGTATCATGACAGTTTCTACT
TCGACGAATCGTTCTTTCACTTCCCTCGGACGAGTCGAGA
CTTCACCGAGAGCAAACATCTCCTACACTACAACCAGTAC
ATGAATGAGGTGCTGCCGGACAGCTTCAAGAGACCCTACC
TGATCAAGATCACCTCCGAGTGGTGCTTCACCTGCATTCA
CATCGAACCCATATGGAAGGACACTGTGCTGGAGCTGGAG
CCCTTGGGAGTCGGTATCGGTGTGGTGGACATTGGATATG
AGAGACAGCTGGCTAACCATCTTGGTGCTCACCGCACGCC
ATCCATTCTCGGTTTAGTCAATGGAAAAGTCACTTTCTTC
CACTACTCTGTGGTCAGAGAACACTTGAGGCAGTTTGTGG
AAAGCCTTCTGCCCCAGAGACTAGTAGAGAAGGTGACCGA
TAGCAACTACCTCGAGTTTTTAAATAGTTGGCATGAGGAG
AACAAGCCAAGAGTGATCATGTTTGATATCGCATCTAATG
TCCCTCTTTTGTACAAGCTCACTGCCTTCGCCTATAAAGA
CTATGTGAGGTTTGGATATGTGGATATGGGCCTGACTGAG
ACCTCCAAAGTCGTGCAGAGATTCAACATTAACACATATG
CGCCAACAATGCTCCTGTTTAAAGAGAACACTGAGAAACC
TGCTGATGTTATACAGGCAAGAGGAATGAAAAAGCAGATC
CTTGACGAGTTTGTGTCAAATAATCGTTTTCTTCTGGTGC
CGCGTCTGGTGAATCAGAAACTCTTTGATGAGCTGTGTCC
TGTTAAACAGTTCCACCGTCGCAGGAAGTACTGTGTTCTG
CTGGTTACTGGTGAAGGAGAGCAGTTTGTGTCCGTGAACG
AAGCCTTCTTTGACTTTGCTTCCTCCAACACTAAGGAAGT
TCTCCGGTTCGCTTATGTTGATCAGAGACAACAGCAACCT
CTTTGTGACACCCTACTCAAGAAAGACGACACAACCCCTC
CACAGGTGATTATCTTGGAGAGACGTAGCACTTCAGGACG
GGTGTTATATCGGACAGTGACGGGCGGATGGAACGGCAGT
GATGATGATAAGCATCGCCTCCATGAGCAGCTTGAGCTTC
TGCAAAGAGACCCCTCCTACCTTACCCATGATGCCATGCT
GCCTGAACTTAACAATGAGTTTGCTTCTATGTTTCTGATT
CAGTGGATAAACACCGCATATGATTACCTGGCTCAGTTTT
ACTTTGATCTTCTCTACTCTAACTGGCGTGAGATGATGCC
TGTTCTGTCGCTGATCTTCTCGGCTCTTTTCATCCTGTTC
GGGACTGTAATCATTCAGGCCTTCAGTGACTCTGGGGAGG
AAAAACCAACCAAACAAAAGGCCACAGAGTCACCAAAGAC
ACCGGAGAGCTCTCCAGGCCCAGAAAGCACTTCAAGTCGT
CCACCTAAGAAGAATTTTGTGGAGGTGACAGAGCTGACAG
ACATCACCTACATGAGCAACTTAGTCCGGTTAAAGCCTGG
TCACATCAACGTGGTGCTGATCCTCACTGATGCTTCTAAA
CAAGTGCTGCTCAGGAAGTTTGCCAAAGAAGTATACTCAT
TCTCAGGGTCTCAGAATCTCCACTACTCCTTTCTAAATGT
GGACAAGCACCGCCAATGGATGGACTCCCTCATGGAGTCT
GCTCCCGACGCCAGGTCGGATGAAGAGGAAGAGGTGGAGG
ACCCCAGCACCAACAAATTAGACCACACGGGCCACGTCCT
GGCGCTCAACGGCCACAAGAAGTACTTCTGCGTATTCAGA
CCCGTGTTTACAGGTGAGGAAGCTGAACGTAGCAGGTACT
CGGATGACGATGCAGCGACCGGAGGAACCAGCAGAACCTC
AAGGTCCCGTTCAAGTTCCCGTCAGAAGGCCACGACTCTG
GAGATCCACCACAAACTGGACCGACTGGGCCTGTGGATGG
AGCGGCTCATGGAGGGAACTCTACCAAGGCACTACGTTTC
AGCCTGGCCCGGTATGGACACCATCACACCGCAGAAATAA
GACTATACCCATAGCAGGAGATGTCGAATTCTAGACCTTT
TTCAATCTCGATTACATGGTCGTTTTTAAAAGATGTTAAG
TTATTTTGTGAAATGCACTGGTTATGAGAGGATATTTAGA
GCAGTGTTTCCCAACTCTGTTCCTGAAGGCACACCAACAG
TACACACTTCCTAATCAAACACACCTGAATCAACTCATCA
GAACATTAGAAAGTCTCCAAAACATGAAGTTAATGAGTCA
GATAGGGGAGACGTCCAAAATATGTTGGTGTGCCTTCAGG
AACAGGGTTGGGGAAACACTGATTTAGAGCACAATTTGCC
TGTTTGCTGCTTTCGAGGTTAAACTCAATTCCCATCTGCC
AGTGTAGGCTCGTTTCATTACTGTACGGATGCCGATACCC
AGATAAAGCCACTCTGTGTAGCTTTGAATAGGGCTAAATG
TGTCTTTACACTGCTGGGGGATTGGCGGCCATTGCGCTAC
TTTATAATTTGGGCCTTCGATTTGGTCCTGACTTAAGAGA
AGCTTGTATTAAAGGGATAGTTGACCCAAAAACTGAACGT
TCTGTCATCATTTACTCAGCATTCAATTGTTAAAACCTGT
TGGACATTCTCCTCTTGAACACAAAAAAACATTGACTTAC
TATGGAAGTCAATGGTTTTCAACTTTCTTCAAAATAGCTT
CTTTTGTGTTCAGAATAAATTCATTAAGGCTTGAAACTGC
TTGAATGTGAGTAAATTGTGGATAAATTACCATTTTTGGG
TGAACTATACCTAATTTAAGGTTACTCATCAGCCTTTTTT
TGCAGTCGGAGTCGTTATTTGGATTATAGAGATTAAAATG
TGTGTGCGTGTGTCTGTATGTGTACGAAAGGTTTCGTTAA
CCCAATTTCCTTATGCAAAATCTCAATTTACTAAACCGTG
CTGCATGAAGAGTTCACTATATTGCATTATAAATACAATC
CTTTAATGCCGTTTGTGCATGTGCTGCCTTTTTATCAGAC
ACCATAGTTACTTTAGTCGATTAATTCATGTTTTGCACTT
TGAAAGACTCGCTTATCTTTCATTCCTAAACTCCATATTT
AAATAGAGACTCTAAATGCATCTGAATCATCACAACCGGT
TGAATAAGATTAAGAATGTCTGTAGATCATGGGTCTCGAT
TCCTGGAGGGCCGCAGCGCTGCACAGTTTGGCTCCAACCC
TAATCAAACACAGCTAATGCTACTAATCAAGGTGTTCGAG
ACTCTTTTAAACAACTTGATTAAGTGATCAGCTGTGCTTG
ATTTTTGACCGCTGCGTCCCTTCAGGAATCCAGCTTTGAG
ACCTATGCTGTAGATCAGGCGTGTCCAAATTCGGTCCTGG
AGGGCCGGTGTCCGGCAAAGTTTAGTTCTAACCACAATCA
GACACACCTGGGCTAGCTAATCAAGCTTTAACTAGGCTTT
CTAGAAACATCCTTGCAGGTGTGTTGAGGCAAGTTGGAGC
TAAAATCTGCAGGATACTTACCCTCCAGGACCGAGTTTGG
ACATCACTGTGTAGATCAGGGGTGTCAAACTCAATCCCTG
GGGGGCCGAAGCCCTGCACAGTTTAGCTCCAACCCTGCTC
CAACACACTTACCTGTAGGTTTCAAACAAGCCTGAAGGAC
TCAATTAGTTTGATCAGGTGTGTTTAATTAGGGTTGGAAC
TAAACTGTGCAGAGCTGTGGCCCTTTTGGAACCTAGTTTG
ACACCTGTGGCATAGATCATCAGTTGGTGGTTTCTTTTAA
AGGGGTAGTTCACCCAATAATGAACGTTTTCTCATTATTT
ACTCACATTCAGCTAATTCTAAACTGAATTTTTTTCTTCT
GTTAAACACAAAAGATGATATTCTGAAGAATGTTGGGGTT
AAAAAAGCAGCCATTGACATCTATAATAGGAACAAAACGT
GTATATATAATGGAAGTGAATGGCTGTTATTTCATAACAT
TCTTCAGTATCTGTCTTTGTGTTCAGCAGAAGAAGAAAAC
TGGAGGATGACTAAATGATTTTTCATTTTGGGTGTACTGT
CTCTTTAAGAAAATGACTTTTTATGTTGCACTATTTTGTG
GTTGATTTATATATCATGTTCATTGTTTAAATAATAATAA
TGATGATAATAATAATAAAGTTTGTACTGTA

dnajc16l TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA dnajc16l-202 5111
ncRNA dnajc16l-002 (1)    Ensembl 538
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dnajc16l-202 Contained in:
[BAC] DKEY-33M11 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000060196 (1),  Ensembl_Trans:ENSDART00000163578 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC115306 (1) 2806 nt
GenBank:CK027695 (1) 816 nt
GenBank:DR727539 (1) 808 nt
GenBank:EB839131 (1) 626 nt
GenBank:EB839121 (1) 599 nt
CITATIONS (2)