ZFIN ID: ZDB-TSCRIPT-141209-1826
Transcript Name: dnajc16l-002
Previous Name: dkey-33m11.9-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000060197 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000060197|OTTDARG00000041770|ZDB-GENE-130530-696 dnajc16l|no_translation DKEY-33M11.9-002 LG_ CR558302.9 Danio rerio protein_coding NOVEL, 538 bp
TTCGCCTATAAAGACTATGTGAGGTTTGGATATGTGGATA
TGGGCCTGACTGAGACCTCCAAAGTCGTGCAGAGATTCAA
CATTAACACATATGCGCCAACAATGCTCCTGTTTAAAGAG
AACACTGAGAAACCTGCTGATGTTATACAGGCAAGAGGAA
TGAAAAAGCAGATCCTTGACGAGTTTGTGTCAAATAATCG
TTTTCTTCTGGTGCCGCGTCTGGTGAATCAGAAACTCTTT
GATGAGCTGTGTCCTGTTAAACAGTTCCACCGTCGCAGGA
AGTACTGTGTTCTGCTGGTTACTGGTGAAGGAGAGCAGTT
TGTGTCCGTGAACGAAGCCTTCTTTGACTTTGCTTCCTCC
AACACTAAGGAAGTTCTCCGGTTCGCTTATGTTGATCAGA
GACAACAGCAACCTCTTTGTGACACCCTACTCAAGAAAGA
CGACACAACCCCTCCACAGGTCAGAGATGGTATTGTCCTC
ATCCACACATTAACTGTTTCCATCCATGAATAAGCCAACG
GACCGACTAAATTGTACA

dnajc16l TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA dnajc16l-202 (1)    Ensembl 5111
ncRNA dnajc16l-002 538
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dnajc16l-002 Contained in:
[BAC] DKEY-33M11 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000060197 (1),  Ensembl_Trans:ENSDART00000161851 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CR930279 (1) 538 nt
CITATIONS (2)