Transcript

mtnr1bb-201

ID
ZDB-TSCRIPT-141209-6
Name
mtnr1bb-201
Previous Names
  • ottdart00000009750
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000009750 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000009750|OTTDARG00000008495|ZDB-GENE-990415-156 mtnr1bb|OTTDARP00000008392 mtnr1bb-001 LG_ BX897671.5 Danio rerio protein_coding KNOWN, 1420 bp
AATCATCTGGCCAGATTCCCCTCTGATCACGCGCTGGATT
TACAATTCCGAGCAGCTGCTTAAAAAATAACTTGGAGCGA
AAGTAACCGTCGCCATGGGGCAACACGGCGCCAACACTGC
CTTGTTGTTTAGTAATTTTAAGGTGAGAGAAAAGCAAGGT
GAACATTCGAGCTAGACAAACAGCTGGAAATGAGTTTGAG
GAGCTGAAAAGATGTTAAGTCGGACTCGTATTTATGAAGA
GAGGAATGAGAGGATCAGCCACACATTCGTGGCTCAACTG
TTACCAACTTCTTCTGCGTGGATGGAGGAATGACTGTCTT
TTACAAGTTGCGAGAATAACTTTTTAAACCTCGAAATACG
AGTTGGTCCGGGATGCCAGAAAACATCGCCTTTTTGACGA
ACAGCACAGATTTGGGGCACGTCGGTCGCGCGTTGGGTTC
GAGCGCGCGCCCCGCCTGGGCGATAGCGGTGCTGGCCAGC
GTGCTGATCTTCACCACTGTGGTGGATGTTTTGGGTAACC
TGTTAGTCATAATCTCGGTGTTCAGGAATCGTAAACTGAG
AAATGCGGGCAACGTGTTTGTGGTCAGTCTGGCCTTCGCT
GACCTGGTGGTGGCTTTCTATCCATACCCGCTGGTGCTGT
ACGCCATCTTCCACGATGGCTGGTCTCTGGGGGAAACGCA
GTGTAAAATCAGCGGCTTCCTAATGGGCCTGAGTGTGATC
GGCTCTGTATTCAACATCACAGGCATCGCCATTAACCGCT
ACTGCTACATCTGCCACAGCTTTGCCTACGGACGTCTGTA
CAGCTTCCGAAACACACTGCTGCTCGTGGCTCTGATCTGG
GCGCTTACCGTACTTGCAATTCTGCCCAATTTCTTTGTGG
GTTCGCTGAGTTACGACCCTCGAGTTTACTCCTGCACGTT
CACACAGACTGCCAGCAGCTCCTACACTGTGGTGGTGGTA
GTGGTTCACTTTCTAGTGCCCATCGCTGTGGTGACCTTCT
GCTACCTGCGGATTTGGGTTCTGGTGATCCAGGTGAGGAG
GAAGGTGAAAAGCGAGGAACGTTCGAGGGTCAGGCCCAGC
GACCTGCGCAACTTTGTCACCATGTTCGTGGTGTTTGTTT
TGTTTGCCATCTGCTGGGCCCCGCTCAATCTCATCGGTTT
GGTGGTGGCCATCAATCCAGAGGTCATGGCTCCACGTGTT
CCAGAATGGTTGTTTGTCGTAAGCTACTTTATGGCTTATT
TTAACAGCTGCCTCAATGCTATCATTTATGGCCTCCTGAA
CAGGAACTTCCGGAAGGAGTATGTTCGGATCATGACGGCG
GTGTGGATTCCTCGGAGGTTTGTGACTGAGACCTCCAGGG
CTGCCACTGACGGGATGAGGAGCAAACCCTCACCGGCCAT
CAATAATAATGAGTGACTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations