ZFIN ID: ZDB-TSCRIPT-141209-402
Transcript Name: eepd1-201
Previous Names: eepd1-001, ch73-171o20.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053569 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053569|OTTDARG00000037511|ZDB-GENE-040426-1831 eepd1|OTTDARP00000042135 CH73-171O20.3-001 LG_ CU928061.6 Danio rerio protein_coding KNOWN, 2345 bp
GCGTTGACATGGACGCTGCTCCCTCCGCTGCCAGACTGAG
AAGACACGACGAAATCTGCTAAAACTGACACGGACTTTTT
CGTATGTCATGGTATGTGAGAAGTCGCAGCTTTAAATTAC
AAGTTCATACATTTGGATTAGTCTATGTGCCACCGGGCTC
TTCCACGCACAGCGTGTAGCGGTCCGGACGGGTTTCATTC
TCAGTTCGCGCGCTGAATCACCGACACACATGGGTGGGAA
TCTCGGGTGCCACCGGTCCATTCCCAAGGACCCTACGGAT
TTCTGCCAAGGCAAGCGCAAGTTCAGCGCGGCGTGCAACT
TCAGCAACATCCTAGTGAACCAGGAGCGGCTGAACATCAA
CACCGCTACCGAGGAGGAGCTCATGACTCTACCGGGCGTG
AACCGCGGGGTGGCTCAGAACATCGTGGAGTATCGGGACT
GCATCGGCGGATTCAAGAAAGTAGAGGACCTGGCGCTGGT
CAGCGGTGTCGGTGCGACTAAACTAGAGGCGATTAAACTA
GAGATCTGCGTGTCGAGCAAGAACAGCTCGTCCAATCACT
CGCCCTCGTCCCTGCGCAAAGAGCACGAGCACCTGCCGTG
CACCGGCGTCAACATCAACACGGCCACGCCGCCGCAGCTC
ATGAGCGTCCGCGGAATCACCGAGAAAATCGCTAAGAACA
TTGTAGAGTTCCGTTCCGTTCACGGTCCGTTCAAAAGCAT
CGAGGACCTGGTCAAAGTAGCCAACATCAACTCATCCCTG
CTGGACCGCATCCGCTTCCAGGTGTTCGTGGAGCGCTCCA
GGACACCATCCACCAACACTAATGGAGGGTTCACGCACCC
GAGCCCCACGTCCTTCAGTGTCCAGAGCGATGAGCCGGAC
GTCCCGCTCGGTGGACCCCCGCTAGTCACCTCCGTCCGGC
CGTGCGTGGAGCCTCCAGCGGGCACGCGTGATGGGAAGCC
CGTGGTGAGGGTCGCCACCTGGAATCTGCAGCGCTGCTCC
AGTGAGAAGGCGAACAACCCGGGGGTGAAAGAGGTGGTCT
GTATGACCCTACTAGAAAACGACATTAAGCTGCTAGCAGT
TCAAGACTTGGCTGACCGGGAGGCTCTAGACAAGTTTTGT
GCAGAGCTGAATCAGCCCACTCTCTGCAGTGTACGCAGAT
GGAAGAGCGCCAGAGGCCTGTGGAAATGTGCCGTTTCAGA
GAAACCCAATGGAGTGTCCAATAGCGCTCCAGAGTTCTCT
GGTTTTCTCTGGGACTGCTCTTCTGGCATTGAAATGAAGG
ATTCTGCCGTCTTGGAGAGTTTTACCACTAATGGTAATGG
GAATCCTCATCCTCAGCCATACCTGGGACATTTTTATATT
GGGTCATCAGAACTGACGCTGGTCAATGTGCTCCTGACTG
CAGCGCCGTCGCCTACAGAAAACAAGAGGAAAAGCACTAG
TGATGATCTGAAGACTCACAAACTGAGCTCTGGTGTCCAG
GAGACCCTCAAAGGTGAGCGAGATTTGCTGGTTTTGGGTC
ACTTTGGTGTAGCTCCTGACAGCTCTGAGATGGAGATTTT
AAGGAAAGAGAAACTGTCGGCTCTCCTCGCACCATCCGTC
TTCACTAACATCAGCACCCGAACACCACAGGGGTCCCGAA
GTCTGGATAATATCTGGGCCAGTCGGTCACTTCGAAAGAC
CTACACCGGTCAGTGTTCGGTAGTGCGCGAGGGTCTCACC
AACCCCTGGATACCTGATAACTGGTCATGGGGCGGCGTGG
CATCTGAACATTGTCCTGTAGTTGCCGAGTTCTTCCTGGA
CGTCCTGAAGGAGCGCCTGTGCAGCGGGCCTGCAATGCCA
GTGGTGGAGAGAGGAGACTCCATGTCCAAACATGAGCGAT
GATTGACTGACTGAATGAACACACATGAAGAGAAGGACTG
AGGTGCACCATGATTGCCTTTGGTTTGTCTGCTCAATGTA
CAGTACAGATTCTATAGCAACAAACATTTGATTTTAGTAT
AGAGCAATACAATGAGACTTATTTAAACAGATTTATTAAA
CATGTACATAAGAAATATGAAGGAACATAAATAAGTAAAT
TATATATGTGCTAACTTTTTAAATGCAAATAATAAATCAT
TATTTACAACCTGAGTGTGTCTATAATGCTGTAATTTTTA
ATATATAGTCAAAATAACATCCGACAATAATCAGTCAGCC
TGCATGTGGCCTCTTTATATTTCAGCATCAAGGTCACACA
GGCTCAGGGGAGTGTTGTAGATTTAGTTTATTTATTCCTG
CATTTGTTTTAGCTGTTTTATGCTCTCATTGTGTTCTCTC
TATCACACACCGATTAATAAACTGC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
eepd1-201 Contained in:
OTHER eepd1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000053569 (1)
  • Ensembl_Trans:ENSDART00000104933 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC065655 (1) 2154bp
    GenBank:AY422999 (1) 2135bp
    GenBank:EH530365 (1) 975bp
    GenBank:EG566707 (1) 907bp
    GenBank:CA470787 (1) 887bp
    GenBank:CN316042 (1) 855bp
    CITATIONS (2)