ZFIN ID: ZDB-TSCRIPT-141209-3555
Transcript Name: si:dkey-219e21.4-201
Previous Names: dkey-219e21.4-001, si:dkey-219e21.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000061917 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000061917|OTTDARG00000042845|ZDB-GENE-141222-59 si:dkey-219e21.4|OTTDARP00000048424 DKEY-219E21.4-001 LG_ CR848021.10 Danio rerio protein_coding NOVEL, 1287 bp
TGAGTTGATAAATGGCAGAGAAAGACTTCAGGCCTTTATC
AGAGGAAACCAGTTCCTTCTGTCTGGCTACTGAGGCTCGT
TCGGGGGTACAAGTCACGCAACCCTTCCCACGCTCTCCAA
AACTAATCAAGAGAACTGGAGCCGTCTCTCCAAAACCCTT
TGAGCTGCCAGTCTTGTTGGAGGACTTGAAGAAGGAGAGG
AAAAAAACAGAATCTCATCTGGAATCTGTTAAAAAGCGGC
AAGCAAACCTCACAACGAGTTCAGAGGCGATGAAGCAGCA
GGTACAGGAGTGCTACGAGGGTCTACATTTGGCTCTGCAG
GAGGATGAGCGGGCCGTTCTGGACATGATAGAGCAAGACC
GCCGGGAAACCAGCAGCAAACTAAATCGAATTCTTCAAGA
CTGGAATCAGCACCTCTGTCTCCTGCAGAAGCACATCTCC
TGCATGCAGTTGGTACAAAGCCCAGAGGAGGCCGTGAAGC
AGCCATTTCCTGAGGATTTTACATTGGCAGGCTGTCGTAA
GAAGCCGGACCCCGCTGAAGGGGAAATCAAAATGAATGAG
GAAAGAATCCTGAAGCTCATGAAGGTTCTTAGAAACATCT
CAAAAGATCTGAAGGCCCAGCTACAAAGAAAGAGCCTGCT
TCTGGACTCCTGTAATGTGGCGATTGACAATCAGACCTGC
CACAAGCAGATCAAGGTGAGCTCAGATGGACGTAGTCTGT
GTCTGTCCCCAGAGGAGCGCGGCGTCCCCAATGAGCCTGT
GAGGTTTGATCAGCTATACTGTGCACTGGGATCTACTGCT
ATTAAATCTGGCCAGCAGTACTGGGAGGTGGATGTGCACT
GCTGTCCGTCATGGGCTGTGGGCATTACCTACGGCAGCTT
GCAGAGGAGAGGAAGAGACAAAGGAGCCAAACTGGGGCGA
AACAGGTGCTCGTGGAGTCTTGAGTTTCAGAATGGGAATC
TGACAGCCTGGCATAATGATCGACACATGCCGCTACCCGT
CACTGCAGCTCGGGCAGCACCGAACAGAGTCGGGGTGTTT
GTGAAGTACCAGAAGGGTCGTGTGGTGTTCTATGATGCTG
AGAGCATGAGGACGCTGCAGGAGTTTTCAGCAGTGCAGAC
AGCTGTGTTTGACAGAGCGCATCATCAGTTTACTGAGCCG
CTTTACCCAGCGTTTCGCTTCTTTTCACCCAAAGATAAGC
ATACAGGCCATCATCATATGCAAATATGTGACCTTAGTCT
TTAATACAGGGTGTCCGCGGGGTCTTAAAATGTCTTTAAT
TTCAAAA

si:dkey-219e21.4 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript si:dkey-219e21.4-202 (1)    Ensembl 677
mRNA si:dkey-219e21.4-201 1287
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-219e21.4-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000061917 (1),  Ensembl_Trans:ENSDART00000153048 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)