ZFIN ID: ZDB-TSCRIPT-141209-2335
Transcript Name: si:dkey-219e21.4-202
Previous Names: dkey-219e21.4-002, si:dkey-219e21.4-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: aberrant processed transcript
Annotation Status: nonsense mediated decay
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000061916 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000061916|OTTDARG00000042845|ZDB-GENE-141222-59 si:dkey-219e21.4|OTTDARP00000048423 DKEY-219E21.4-002 LG_ CR848021.10 Danio rerio protein_coding NOVEL, 677 bp
AGTGAGTTGATAAATGGCAGAGAAAGACTTCAGGCCTTTA
TCAGAGGAAACCAGTTCCTTCTGTCTGGCTACTGAGGCTC
GTTCGGGGGTACAAGTCACGCAACCCTTCCCACGCTCTCC
AAAACTAATCAAGAGAACTGGAGCCGTCTCTCCAAAACCC
TTTGAGCTGCCAGTCTTGTTGGAGGACTTGAAGAAGGAGA
GGAAAAAAACAGAATCTCATCTGGAATCTGTTAAAAAGCG
GCAAGCAAACCTCACATAACTGCTGAATTGTTCATCTCTG
GTGAAGACGAGTTCAGAGGCGATGAAGCAGCAGGTACAGG
AGTGCTACGAGGGTCTACATTTGGCTCTGCAGGAGGATGA
GCGGGCCGTTCTGGACATGATAGAGCAAGACCGCCGGGAA
ACCAGCAGCAAACTAAATCGAATTCTTCAAGACTGGAATC
AGCACCTCTGTCTCCTGCAGAAGCACATCTCCTGCATGCA
GTTGGTACAAAGCCCAGAGGAGGCCGTGAAGCAGCCATTT
CCTGAGGATTTTACATTGGCAGGCTGTCGTAAGAAGCCGG
ACCCCGCTGAAGGGGAAATCAAAATGAATGAGGAAAGAAT
CCTGAAGCTCATGAAGGTTCTTAGAAACATCTCAAAAGAT
CTGAAGGCCCAGCTACAAAGAAAGAGCCTGCTTCTGG

si:dkey-219e21.4 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript si:dkey-219e21.4-202 677
mRNA si:dkey-219e21.4-201 (1)    Ensembl 1287
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-219e21.4-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000061916 (1),  Ensembl_Trans:ENSDART00000163755 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CF265979 (1) 967 nt
CITATIONS (2)