Transcript

si:ch211-133l11.10-202

ID
ZDB-TSCRIPT-141209-354
Name
si:ch211-133l11.10-202
Previous Names
  • ch211-133l11.10-001
  • si:ch211-133l11.10-001
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052585 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052585|OTTDARG00000036913|ZDB-GENE-141219-14 si:ch211-133l11.10|OTTDARP00000041337 CH211-133L11.10-001 LG_ AL929114.8 Danio rerio protein_coding NOVEL, 1422 bp
GCTCGTCTGTCAATCAACCGGACCGAACTTGACTTGAGAG
CGCGAGAGAAACAACCCAGCAGGCGTCATTTAGCGATGCA
GGAATGGTAAATAAAGCTGTATTCTACACACACCATACCA
TGATAGCGACCACAGTCGTGTTTAAAAGTTGCATTTGTTG
ACCGGATAACGCAATGCCGTCGCAGGATGATGCCGAGTCG
GTAAATGAAGACGATTTTCCGCCTCCGGTTCCACCGCGAG
TAGCTCCACCGCGAGACACGCCGGCAGCATCTGAACGCCG
GGTAAAGTGTGTGATGGTCGGCGATGGAGCGGTGGGTAAA
ACCAGTCTGATTATCAGCTACACCACCAACGGATATCCGG
CAGAACACATTCCCACTGCCTTTGACAACTTCACAGCCAG
GGTAGTGGTGGACGGGAGACCAGTTCAACTTCAGCTGTGT
GACATGGCAGGACAGGATGACTTTGACCGACTCCGCCCAC
TCTGTTACCGTGATGCTGATGTGTTCCTGCTCTGCTACAG
CGTGGTCCTCCCATCCTCCTTCAGAAGTGTGACTGACCGA
TGGGCTCCTGAAATTAATCGAATCTGTCCTGGTGTTCCCA
TCATCCTCGTGGGCACTCAGTGTGATTTACTTGAAGACGT
TCAGGTGCTTATCCGACTCGCAGAGGGCCAGGAGAAACCA
GTGAGCCAGGAAGACGCCCGATTGTGTGCCCGTAGCATCG
GTGCCGTGACATTCGCTGAATGTTCAGCTCTGACACAGAA
GAACCTGAAGGAAGTGTTCGACGCCGCCATCTTAGCTAGC
ATGAAGCATGCAGAGGAGTCGATGTGGCCGAGGATCCAGA
CGCTGAGAGAAAAAACCCCAGATAAAATCAGACAGCTTTC
TGAAAGCTGGTGGAAGAAACTGAGCTGCGTCCAGAGCTTT
GATTTTCAGTGACAGAGGATCCGCTGGTGGGTTTGAGTTG
CCTTTTTTGATACATCAGAAGCTCACAATGTAAACAAATG
TTCTTAAAGAAATCTCGGTGTGATTTGGCTCAGCATTGCT
AGCGCTGGATTAGCTGATCCTGTGAACAGACTGAAGATCA
GGACTAAAGGAGAGGGATTTGAGCTCTGCGTTACACCTGT
TGTGCTCCCCTATAATCTGATGTTCATTAGCAACGTCATT
TCTGCCGTTTACATCATTTTGTACTGTGAAAATTGTGCTT
GTTGCTGCTTGTTCAAATGACTTATTTAAAATGAACTATC
AATGCAATTCTAGAGTTTTTTGGGGGGGACGACTTAATGA
TTTTATGTTCCATCCACTTAAATTTGTAAAAATAATTAAG
TCAGCTTAATCGGTTTGTGTTTGGACAAAATTGTGTGGAA
CACAGTATTTGTTTATTTATTTTTTTTGCAAAATAAGTGT
AAAATGAGAACTGTCCCACCAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations